Single base extension (SBE) primers of wheat genome-specific SNP loci

Save as a tab-delimited text file  |  Save as an Excel file

IndexSeq IDCountPrimer typeOrientationStartLengthTmGC%Any compl3' complQ ScoreSNPPosPrimer SeqProd SizeSeq LengthIncluded LengthPair Any complPair 3' compl
1AF085169_3_B_14141SBEREVERSE412563.67368274T/C14AAAATGCATTACTTACACGGCAACA
2AF085169_3_B_57571SBEFORWARD302758.2529.638394.76T/C57TAATGCATTTTGTCATGTGTATCTAGT
3AF085169_3_B_61611SBEFORWARD342762.4937.044288.36G/T61GCATTTTGTCATGTGTATCTAGTGGAA
4AJ612027_5_A_4104101SBEFORWARD3822859.8242.868392.8A/C410CCTCTCAGACACTAGGTACTCAGAAATA
5AJ612027_5_A_4104102SBEREVERSE4382657.9342.316385.87A/C410TACTGACCCTTAAGAGCACACTACTA
6AJ612027_5_A_4734731SBEFORWARD4462761.1637.044190.69T/C473AGTTTAGGGGAGTTCTTTCTTAATGGT
7AJ612027_5_A_6396391SBEFORWARD6142564.61444268.66G/T639AAATAGTCGGTGTTCAAGCAACAGG
8AJ612027_5_B_72721SBEFORWARD452762.6540.744389.54T/C72TTGGAGGTTAGTGATGGTCTAATATCG
9AJ612027_5_B_72722SBEREVERSE1012759.3537.045294.5T/C72ATCATAGAGGCTAAGAGAGACAAACAT
10AJ612027_5_B_2262261SBEREVERSE2552763.3140.744285.9T/C226CAAAATAGTCTGTCACCATCAAAGGAG
11AJ612027_5_B_3753751SBEFORWARD3502564.53444268.9T/C375ACCATGATCTTACTTTGGTGCGTTC
12AJ612027_5_B_3753752SBEREVERSE4042763.6633.334183.19T/C375ATGAAAAGATTACCGAAGCAAATCAAC
13AJ612027_5_B_5955951SBEREVERSE6242757.9833.334289.76A/T595ATTAAGAAAGAACTCCCCAATACTAAC
14AJ612027_5_B_6086081SBEREVERSE6372757.4729.634288.24G/T608TCTATCACCAAGAATTAAGAAAGAACT
15AJ612027_5_D_71711SBEREVERSE1002760.6525.936396.8G/T71TTTAAAAAGGTTGCATAATTTCAGAGA
16AY244508_5_A_2702701SBEFORWARD2452562.93406376.63T/C270CAAATTTTATTGACAGAGGTCCGTG
17AY244508_5_A_3163161SBEREVERSE3432564.12444270.15T/C316CTGGTTTGAGGCTGAGTTTGATCTT
18AY244508_5_A_3573571SBEFORWARD3322563.4444272.3G/C357CCTCAAACCAGCTCTTCATCTTCTT
19AY244508_5_B_4334331SBEFORWARD4062762.1537.043390.42G/C433TACATCACAAGTCCATTCCTATTCAGA
20AY672996_5_D_91911SBEFORWARD642762.1233.334289.48G/C91TTTCATTAACCCCAGTAAATTGTGTCT
21AY672996_5_D_91912SBEREVERSE1202759.2637.044395.27G/C91TATTAGTAGTTTCAGTTCTGCATCACC
22AY672996_5_D_3133131SBEREVERSE3422754.8422.224280.36A/C313CCATGTAGCTGTAAAAATAAATAAATA
23BE352570_7_B_4734731SBEFORWARD4482550.36207357.13T/C473TAACTGTTAGAATAACATGAAATAA
24BE352570_7_D_3423421SBEFORWARD3152762.0125.936291.06G/C342AAATTTGAATCATTTGGATCTTGGATA
25BE352587_3_D_88881SBEFORWARD612757.5229.634288.39T/C88CCCCATCTGTATATTTTCTATTTTCTA
26BE352587_3_D_2172171SBEFORWARD1902762.5937.043287.43A/T217AGCAAGTGTTGTTCCTAATGTTTCAGT
27BE352587_3_D_3713711SBEREVERSE4002764.2344.443282.53T/C371CAGAATGATGGAGAGGGTAATAGTTGC
28BE352603_5_A_8208201SBEFORWARD7932764.3937.045384.95A/C820TGTTCCCAACAGATTGAGGTTTAATTC
29BE352603_5_A_8208202SBEREVERSE8482664.1442.314276.74A/C820ATCTTATATTTTGGGACGGAGGGAGT
30BE352603_5_A_8638631SBEREVERSE8953058.0623.338372.18G/C863CCAAAATATAAGATCATTTTTTAGACACTA
31BE352626_4_A_1101101SBEREVERSE1392763.5737.043383.93T/C110ACTCACCTTCTCCTGTTTTTTCATCAT
32BE352626_4_A_2682681SBEREVERSE2952560.2445282.52T/C268GAACTGGTACTCCACTTTGGTTATG
33BE352626_4_A_4964961SBEFORWARD4692762.433.336289.89A/C496TAGTGATATCTGTGGCATTTCATTTTG
34BE398199_7_D_3683681SBEREVERSE3972761.6233.337292.84T/C368AATACTGAGTCAATGCTCAAACAAAGA
35BE398199_7_D_3993991SBEFORWARD3722761.4729.637293.29T/C399TTTGTTTGAGCATTGACTCAGTATTTT
36BE398199_7_D_3993992SBEREVERSE4282756.5425.936283.75T/C399ATTAAACTAGGTAAAAAAAAGAACTGC
37BE398302_2_A_1541541SBEFORWARD1282654.2723.088376.15G/C154TATTTATGGAATTCAAGTAAGAAACT
38BE398417_7_B_5065061SBEFORWARD4812564.68444268.46T/C506TGCTGGAAGTAGTTGCTTTTATGCC
39BE398417_7_B_5565561SBEFORWARD5282859.6235.718392.21T/C556TGAGTAATACGTAAAAGTCACCTCTTTC
40BE398417_7_B_5565562SBEREVERSE5832562.41364173.6T/C556CTCAGTGGTGATGAAAAACATGAAA
41BE398523_4_A_5435431SBEFORWARD5162757.6733.336290.11G/T543ATTAGTATAATCTAGTCACGTTTTGGC
42BE398523_4_B_3223221SBEREVERSE3502659.8738.464390.44T/C322TTACAAACATGAGGCATAGACCTAAC
43BE398523_4_B_7207201SBEREVERSE7492760.1629.635397.64T/C720TGCATCTCAAACAATCATTACATCTAT
44BE398523_4_B_8068061SBEFORWARD7792760.8629.638397.43T/C806TTTGCGTAAAAATATTTCAGATAGTGG
45BE398591_7_D_771SBEREVERSE362759.5833.334294.58G/T7CATTGTTCTTCTTCTATTCCTACGTTT
46BE399200_2_D_1871871SBEFORWARD1622564.77484268.2T/C187GATGATGTGGTCATTCCAGTATCCC
47BE399200_2_D_4614611SBEREVERSE4902758.1640.748394.47T/C461TTACTAGGCCTACATACGACTGACTAT
48BE399200_2_D_5155151SBEREVERSE5422556.02324270.57G/T515GAAATACTAATCCATGCTAACTTCA
49BE399500_3_D_3743741SBEFORWARD3472757.4322.223183.23T/C374TAAGTGTTTTTTTATTCTCCTTTTTGT
50BE399500_3_D_5235231SBEFORWARD4962753.1625.936276.56A/T523ATTTCTGGTAGATATGTAAAATTAGTC
51BE399500_3_D_6736731SBEREVERSE7022759.2625.934392.7A/T673AAATCGTATTCTTTTTTTGATGGTTAC
52BE399500_3_D_7427421SBEFORWARD7152758.1733.334392T/C742TCTATATCTGTTCCCTCTGTTCTTAAA
53BE399630_5_D_2542541SBEFORWARD2272758.8337.045292.96T/C254CCAGAGTTTAGGTTAAAGTTGTAGGTT
54BE399630_5_D_3673671SBEREVERSE3962763.7140.747286.59T/C367GTACACTGAACACAGTTCATCAAAGCA
55BE399688_2_B_2592591SBEFORWARD2322761.6237.044290.99G/T259GTCATATCTTTGCATACAGTGGTCAAT
56BE399688_2_D_17171SBEREVERSE442561.58445278.37G/T17CATATAGTGGTCCATTCCCTCATCT
57BE399688_2_D_72721SBEFORWARD452758.1529.634290.27A/C72AAAGATATGACAATTCAAGTCCATTAC
58BE399688_2_D_72722SBEREVERSE992563.69444271.43A/C72GGTCCATCTAGCTCCGAATTTACAA
59BE399814_2_A_1831831SBEFORWARD1562760.4825.936397.3T/C183TCAAAAACATAAATTTGACTGGAAACT
60BE399936_2_A_3733731SBEFORWARD3452860.4535.714287.83T/C373CGTACTAAACATAAATCAAGAACCACAC
61BE399936_2_A_4004001SBEFORWARD3742664.0146.155277.75T/C400CTAAATCTACCGCTATTACGGCCAAC
62BE399936_2_B_661SBEREVERSE332563.76364268.81T/C6CATGTGATTTCCCCTTTTTTGTTTC
63BE399936_2_D_69691SBEFORWARD442562.18406277.2A/T69GAATCACATGAGAAGGAATCAAACC
64BE399936_2_D_69692SBEREVERSE982759.2833.335395.96A/T69TTATCTGGCTTTGTAACATTCTAGTTG
65BE399939_5_A_4164161SBEREVERSE4432564.61404167.02T/C416CCACATTTCAGCTTCTTTCACCATT
66BE399939_5_D_1481481SBEREVERSE1772762.7729.636390.43A/T148GTCGATAAAGAAATTGCATTGAAGAAA
67BE399939_5_D_1561561SBEFORWARD1302661.2734.627287.22T/C156CTTCTTTCATGATTCACGAGTTTCTT
68BE399939_5_D_1911911SBEREVERSE2202760.5429.634294.22T/C191TCAAAAAGGTAAGCCATCTTAATCATA
69BE399966_5_A_4704701SBEFORWARD4432754.7233.334280T/C470TACTTGATAGGAGATACTTATTACACG
70BE399966_5_A_4704702SBEREVERSE4992761.9337.043187.76T/C470GGTAACAAGAGAAACAAAGGGATAACA
71BE399966_5_B_4364361SBEREVERSE4652760.8333.336192.92T/C436AATGGTAATAACAATAGAAACAAGGGG
72BE399966_5_D_55551SBEFORWARD302563.78486272.4T/C55GGGTGCACTATGCTAAGATGACTGA
73BE399966_5_D_2732731SBEREVERSE3022762.337.043186.65T/C273CGACCAAAGGATAAGAATCAATAACAG
74BE399966_5_D_3593591SBEFORWARD3332661.2742.315387.65T/C359AAGTACCTGATCGGATGGAGTATGTA
75BE399966_5_D_3593592SBEREVERSE3882760.0329.634397.41T/C359GAAAAGGATGAAACAATCAGAATATGT
76BE399980_1_A_2452451SBEFORWARD2182757.0233.334286.89T/C245ACCCATATACAAGTAGGTTTCATAAGT
77BE399980_1_B_63631SBEREVERSE922758.9337.046395.55T/C63CTACTTGTATATGGGTAGGCATTGATA
78BE399980_1_B_88881SBEFORWARD612761.9537.046291.25G/C88AGGATATCAATGCCTACCCATATACAA
79BE399980_1_B_1391391SBEFORWARD1122764.4240.746385.49G/T139AGCAGTTCCAGATATCAGAAGGCATTA
80BE399980_1_B_1391392SBEREVERSE1662564.77405268.8G/T139TAATGCCATGCTGTTCTTCCGTTAT
81BE399980_1_B_3283281SBEFORWARD3012761.6737.044290.83A/T328ATGAAGGTATAAGCAACCAAGTGAAGT
82BE399980_1_D_3713711SBEFORWARD3442758.5933.333290.99A/T371GTAAGGTATCAGCAATCAAATAATGTC
83BE399999_1_D_1411411SBEREVERSE1702764.0237.046386.7A/C141ACAGTTGCATATAGAACATGGCTGAAA
84BE403152_6_B_2562561SBEREVERSE2862857.42256382.19G/T256GCATTATAAAAAATAACTATGTTGAAGC
85BE403152_6_D_4474471SBEREVERSE4762752.2622.224374.28A/C447TTATGAGTATCCACTTACATTTATTAT
86BE403152_6_D_4654651SBEFORWARD4382754.0522.225380.28G/C465TCATACAACAAATAATAAATGTAAGTG
87BE403154_6_A_45451SBEFORWARD202564.54485269.51G/T45GACTTTCACAGCTTTAAGACACCGC
88BE403154_6_A_47471SBEREVERSE762759.8740.744397.12T/C47CTCAGAACTCTACAGGAAGGATAAAGA
89BE403154_6_A_97971SBEFORWARD702764.3940.746385.58T/C97TCTGAGATATCCTGCCCTTTTAGTGAA
90BE403154_6_A_97972SBEREVERSE1262762.237.044289.22T/C97CTTAAATCAAAGAACCTTCACACTCGT
91BE403154_6_A_1101101SBEREVERSE1392759.8740.744397.12T/C110CTCAGAACTCTACAGGAAGGATAAAGA
92BE403154_6_A_1111111SBEFORWARD842762.4940.744390.04G/T111CCCTTTTAGTGAATTACGAGTGTGAAG
93BE403154_6_A_1111112SBEREVERSE1412855.3321.436378.07G/T111GAAAAATATTGTCTACTTAAATCAAAGA
94BE403154_6_A_1351351SBEFORWARD1082755.5925.934384.26A/T135AAGGTTCTTTGATTTAAGTAGACAATA
95BE403154_6_A_1351352SBEREVERSE1642758.2333.336291.78A/T135ATCTATGGCTAGTAACAGAACAAGAAA
96BE403154_6_A_1531531SBEFORWARD1262754.7225.936382.92A/T153TAGACAATATTTTTCTTGTTCTGTTAC
97BE403154_6_A_1531532SBEREVERSE1822755.7129.633282.33A/T153ATGAGTGTCTTATTATTTATCTATGGC
98BE403154_6_A_1601601SBEFORWARD1332764.3940.746385.58T/C160TCTGAGATATCCTGCCCTTTTAGTGAA
99BE403154_6_A_1601602SBEREVERSE1892762.237.044289.22T/C160CTTAAATCAAAGAACCTTCACACTCGT
100BE403154_6_A_1741741SBEFORWARD1472762.4940.744390.04G/T174CCCTTTTAGTGAATTACGAGTGTGAAG
101BE403154_6_A_1741742SBEREVERSE2042855.3321.436378.07G/T174GAAAAATATTGTCTACTTAAATCAAAGA
102BE403154_6_A_1981981SBEFORWARD1712755.5925.934384.26A/T198AAGGTTCTTTGATTTAAGTAGACAATA
103BE403154_6_A_1981982SBEREVERSE2272758.2333.336291.78A/T198ATCTATGGCTAGTAACAGAACAAGAAA
104BE403154_6_A_2162161SBEFORWARD1892754.7225.936382.92A/T216TAGACAATATTTTTCTTGTTCTGTTAC
105BE403154_6_A_2162162SBEREVERSE2452755.7129.633282.33A/T216ATGAGTGTCTTATTATTTATCTATGGC
106BE403154_6_A_3453451SBEREVERSE3722561.96446379.54T/C345CTTGTTCCAACATATCCTCTAGCGT
107BE403154_6_A_4084081SBEREVERSE4352561.96446379.54T/C408CTTGTTCCAACATATCCTCTAGCGT
108BE403154_6_B_73731SBEFORWARD462760.4425.938398.68G/C73TAAAATCTGTAAATTTTGAAGGGAACA
109BE403154_6_B_83831SBEFORWARD572664.7138.465377.32T/C83AATTTTGAAGGGAACAGTTTCACAGC
110BE403154_6_B_1261261SBEFORWARD992758.6440.747395.29T/C126GTTGCTACTTAGCTGCTATCTACTTTG
111BE403154_6_B_1271271SBEFORWARD1002758.6437.047293.62G/C127TTGCTACTTAGCTGCTATCTACTTTGT
112BE403154_6_B_1561561SBEREVERSE1852760.8340.744293.34T/C156AACTCTACAGGAAGGATAAAGACAAGC
113BE403154_6_B_1671671SBEFORWARD1412661.5142.318287.13T/C167GCAGCTGCTTAGTATATGCTTGTCTT
114BE403154_6_B_1671672SBEREVERSE1962761.5644.446292.41T/C167GGATATCTCAGAACTCTACAGGAAGGA
115BE403154_6_B_2182181SBEREVERSE2472758.9429.634394.31T/C218TTGTCTACTTAAATCAAAGAACCTTCA
116BE403154_6_B_2292291SBEREVERSE2582754.8222.226383.2T/C229CAAGAAAAATATTGTCTACTTAAATCA
117BE403154_6_B_3853851SBEFORWARD3582763.2429.636287.38A/T385TAAACATTTTAATTTTGCACCGACAAG
118BE403154_6_B_4324321SBEFORWARD4052762.1144.443390.54T/C432AGGACCATCTTACCTTGTGTAGCATAG
119BE403154_6_B_4544541SBEFORWARD4272764.7437.046384.52T/C454CATAGATGCCATGCATTGATATGGTTA
120BE403154_6_B_4874871SBEFORWARD4602761.6840.746393.7T/C487ACGCTAGAGTATATGTTGGAACAAGGT
121BE403154_6_D_18181SBEREVERSE472757.8333.334289.31T/C18CTACTTAAATCAAAGAACCTTCACACT
122BE403154_6_D_1301301SBEFORWARD1032758.9240.747294.46T/C130ACTTAGCTGCTATCTACTTTGTCCTCT
123BE403154_6_D_1721721SBEFORWARD1452761.2737.044190.34A/C172GCTTGGTATATGCTTGTCTTTATCCTT
124BE403154_6_D_1721722SBEREVERSE2012763.7644.446387.46A/C172AAGGGCAGGATATCTCAGAACTCTACA
125BE403154_6_D_2122121SBEFORWARD1852764.0444.446386.63T/C212GAGATATCCTGCCCTTTGAGTGAACTA
126BE403154_6_D_2122122SBEREVERSE2412757.8333.334289.31T/C212CTACTTAAATCAAAGAACCTTCACACT
127BE403154_6_D_2192191SBEREVERSE2472662.1846.154384.29T/C219CACCTATGCTACACAAGGTAAGATGG
128BE403154_6_D_4134131SBEREVERSE4412662.1846.154384.29T/C413CACCTATGCTACACAAGGTAAGATGG
129BE403177_2_A_2822821SBEFORWARD2552758.3129.637394.29T/C282AGTACCAGTCAAATGATTTTATTCAAG
130BE403177_2_B_2822821SBEFORWARD2552758.3129.637394.29T/C282AGTACCAGTCAAATGATTTTATTCAAG
131BE403177_2_D_1201201SBEFORWARD932758.3129.637394.29T/C120AGTACCAGTCAAATGATTTTATTCAAG
132BE403177_2_D_3113111SBEFORWARD2832864.8732.146171.64A/T311TATCATGACATCAGTGCGAGATTTTTTT
133BE403201_3_D_3793791SBEFORWARD3522759.0433.336294.21A/T379TGTGCTTCTAGATTTGTCTTTATCTGT
134BE403201_3_D_3793792SBEREVERSE4082760.6533.336396.8A/T379GTCTGTTGCAATACAGATTTTATGTGA
135BE403201_3_D_5145141SBEREVERSE5432760.9433.335293.64T/C514CTGTATTCTCAAACACAATCTTTCCAT
136BE403211_5_A_6016011SBEFORWARD5742756.9522.224286.69T/C601ATTATTGCTTTAACACTTGATTTTGTA
137BE403214_5_B_86861SBEREVERSE1152761.7337.046393.55T/C86CTCCAGATATTGTACACAGCAAACATT
138BE403214_5_B_3243241SBEFORWARD2962859.3135.718289.6T/C324TGATGTTAGCTAAGTAACTGATATGTGC
139BE403305_5_A_1641641SBEFORWARD1392564.6404370.36G/T164CCAGGATGCAACTTTGACTTTTGTT
140BE403305_5_A_4234231SBEREVERSE4522763.2333.333183.85T/C423ACTGATAATGAAAGATGACAAAGCCAA
141BE403322_1_A_1021021SBEFORWARD762663.9346.155379.68A/C102GATGATCCCAAACTGTACCACTATGC
142BE403322_1_A_4264261SBEREVERSE4542661.3238.468287.71A/C426CACTTTGTGCCCTAAAGTAATAATCG
143BE403322_1_D_3083081SBEFORWARD2832561.66366380.43A/C308CTGGAAAAGCAACAATTGAAGTACA
144BE403352_2_A_4424421SBEFORWARD4172564.58366368.09T/C442AGAAAAAAAAATCGATGCACCCTTC
145BE403352_2_A_4654651SBEFORWARD4362955.1531.036370.88G/T465CCCTTCTGATTTACTATATTACTTCTACT
146BE403352_2_B_5675671SBEFORWARD5402762.9437.046186.6T/C567GTTTATAATACCATTTCCGATTCTGCC
147BE403352_2_D_2692691SBEREVERSE2982756.533.336286.6T/C269CTAAAGTACTAAAGTTCATTCTTGTGC
148BE403352_2_D_2892891SBEFORWARD2622764.9533.336383.89G/T289TTGCAGATTGCACAAGAATGAACTTTA
149BE403352_2_D_4154151SBEFORWARD3882762.9437.046186.6T/C415GTTTATAATACCATTTCCGATTCTGCC
150BE403378_4_B_2352351SBEFORWARD2082759.8329.636398.23T/C235TTTATATATGCTGATATGCTGAATTGC
151BE403378_4_B_2352352SBEREVERSE2622564.77406269.44T/C235TTTAAAATGAGGGTCCCAGACAACA
152BE403378_4_B_2672671SBEREVERSE2962760.1233.334397.14T/C267CTCTGCACAATACAAGTAAAGATTCAA
153BE403378_4_D_2592591SBEREVERSE2882761.3840.746394.62T/C259CATCACCTTAAGATACTCATCGACATC
154BE403420_1_D_3133131SBEREVERSE3422753.7622.227380.65T/C313TTAAAAGTATCATAATTCTCTCTGTTT
155BE403421_6_A_2882881SBEFORWARD2612759.5133.335396.64T/C288CCTTTGATACTAAAATTGCCACTTACT
156BE403422_6_D_4484481SBEREVERSE4803056.05203159.7A/C448CACTAAACAGAAAGAATAACTAATAAAAAA
157BE403422_6_D_5305301SBEFORWARD5032764.7744.447181.74T/C530TTTATAAGCTGAGTGAGCATACGAGGG
158BE403506_2_A_2682681SBEREVERSE2962661.0534.625388.32T/C268GTGAAGCATTTTGAAGGTAGTTCATT
159BE403506_2_B_3953951SBEFORWARD3682762.5933.335390.35A/C395TCTGTATCATGCAATTTATGGGTTGTA
160BE403506_2_D_2952951SBEREVERSE3242762.2337.044390.82G/C295GAAAAGAGGTTTGCCTATGAGGTATTT
161BE403516_2_A_2542541SBEFORWARD2292564.38404367.81T/C254CAGACAAAAAAAAGATCAAGGCTGC
162BE403516_2_D_1641641SBEREVERSE1922663.9442.314379.01A/T164GTCATACATTTTCTTGACAGCAGCCT
163BE403569_4_B_5575571SBEREVERSE5852660.6238.468391.47G/T557TAGTCATGTATACAAGCCAATTCTGG
164BE403597_2_A_2642641SBEREVERSE2912563.8444372.78T/C264GCAGTTCTAATTCCCAAGCAGGTTA
165BE403597_2_A_4904901SBEFORWARD4632762.7840.746390.42T/C490TGTGGTTTCTTTAATACTACAGGCAGG
166BE403597_2_B_5525521SBEFORWARD5252761.2637.044292.06T/C552AGCACAAATGTCTAGTTTAGCTTCCTT
167BE403622_7_B_69691SBEREVERSE982763.9140.744385.77T/C69TACATCGTGAAAGTGCTAAACTTCGAG
168BE403622_7_B_2742741SBEREVERSE3012563.74402270.03G/T274CAAGCAATCAAATGTCCCAAGTATG
169BE403622_7_B_3093091SBEFORWARD2842560.39363280.72G/T309GGACATTTGATTGCTTGAACTTTAG
170BE403622_7_B_3093092SBEREVERSE3382761.0437.045293.34G/T309TATTCAGGCAACTTACGAATAGTCAAC
171BE403622_7_B_3103101SBEREVERSE3392760.633.335396.33A/T310ATATTCAGGCAACTTACGAATAGTCAA
172BE403622_7_D_4294291SBEFORWARD4042563.19485375.21G/C429CACCCTTCCAGGTTGTAACTTTAGG
173BE403622_7_D_4294292SBEREVERSE4582761.3529.636394.71G/C429ACAAATCCCTGAAATTGCATATTAGTT
174BE403631_1_A_1121121SBEREVERSE1412761.9640.744391.62T/C112CTAACTTTGCTGGTGTTTTTCTCTAGG
175BE403631_1_D_2622621SBEFORWARD2352759.6733.336296.1T/C262ATAAATACTAACCTGTTGGTTGAAGGA
176BE403631_1_D_2622622SBEREVERSE2912758.9429.633289.79T/C262TAAGTAAAAAAGAGTCACATCCAAAGA
177BE403637_4_A_3713711SBEFORWARD3462564.96486370.55T/C371TGGACATGTGTAAGGGAGTGCAGTA
178BE403637_4_A_4014011SBEFORWARD3762564.77444268.2A/T401ATGAAATCAAGGACTCTGTTGTGGC
179BE403637_4_A_4194191SBEREVERSE4472662.5346.154179.9T/C419GTTCTCCTCACATAGTGCTCCTTCTT
180BE403710_5_B_82821SBEFORWARD552760.833.338397.59T/C82GCACATAATAATTTGCATCCTGTTACT
181BE403710_5_B_82822SBEREVERSE1112761.2429.635292.72T/C82CATCATGTCATAAGCATACAATTCAAA
182BE403710_5_B_1301301SBEREVERSE1592762.1937.045289.9T/C130AGAGGAAATTCTAATCAACATGACAGC
183BE403710_5_B_1321321SBEREVERSE1612759.5129.635396.65T/C132TTAGAGGAAATTCTAATCAACATGACA
184BE403710_5_B_1331331SBEREVERSE1622758.3629.635291.54A/C133TTTAGAGGAAATTCTAATCAACATGAC
185BE403710_5_B_1441441SBEFORWARD1192561.67408279.99T/C144CATGATATCTTGTGCTGTCATGTTG
186BE403710_5_B_1481481SBEFORWARD1212761.8833.336291.44G/C148TGATATCTTGTGCTGTCATGTTGATTA
187BE403710_5_B_1821821SBEREVERSE2112756.922.225388.83G/C182AAACATCATTTTGTAAAGCATATAAGA
188BE403710_5_B_2152151SBEFORWARD1882757.9522.225391.98G/C215ATATGCTTTACAAAATGATGTTTTCTT
189BE403710_5_B_2152152SBEREVERSE2422564.6445269.32G/C215TACCACCATTTGTTCGGTTACCACT
190BE403710_5_B_2232231SBEFORWARD1962761.2629.635394.35A/T223TACAAAATGATGTTTTCTTCAAGTGGT
191BE403710_5_B_2352351SBEFORWARD2092663.1234.625382.09T/C235TTTCTTCAAGTGGTAACCGAACAAAT
192BE403757_3_D_1831831SBEREVERSE2122763.5637.044285.15T/C183AAGGGGTCATTAACTGCAAAACAATAG
193BE403803_2_A_2602601SBEFORWARD2342664.2446.156277.71G/C260AGGCGCCCTAATATCGAGGTACTAAT
194BE403803_2_A_2602602SBEREVERSE2882664.438.465378.26G/C260TTGATGAGTCAATGAGTTGTGATTGG
195BE403803_2_A_2722721SBEFORWARD245276237.044188.17T/C272TATCGAGGTACTAATCACCAATCACAA
196BE403818_6_A_74741SBEREVERSE1032761.5529.634291.2A/C74ATGCTTTAATGTTTTACTTTGGGAGAA
197BE403818_6_B_1751751SBEREVERSE2022562.78404375.83T/C175AGAAAAACAGTCGAAACGTACATGC
198BE403900_4_A_2882881SBEREVERSE3172762.4940.744390.04T/C288GCTCAATAATAAGGTGTTCCTCTTGTG
199BE403938_6_A_1051051SBEFORWARD792661.8642.316386.5T/C105ATCTCATGCTTGGGAGTGTTACATAG
200BE403938_6_A_2162161SBEFORWARD1902661.2634.628389.54A/C216CATTGATTGGCCATTCTCTTATTTAG
201BE403938_6_A_4684681SBEFORWARD4422663.6446.154379.92T/C468GAGTGATGGAGCTTGTCGTTTTAGAC
202BE403950_6_B_68681SBEREVERSE982857.6932.146383A/T68CAGAGACATTTTTTCTATATTAGAGCTG
203BE403950_6_B_3093091SBEREVERSE3382763.1440.744286.41T/C309GATCAGGGCATTCATAAAACTACACAG
204BE403950_6_B_3253251SBEFORWARD3002561.65444277.54G/C325GGTTCACCGACCTGTGTAGTTTTAT
205BE403956_1_A_2322321SBEFORWARD2072563.07521063.27G/T232AGAGGAGAGTGAGTGTGTGTGTGTG
206BE403956_1_B_7837831SBEFORWARD7562762.0433.334391.37T/C783GCAACTTCTCCTTTCATACAACAATTT
207BE403956_1_B_7837832SBEREVERSE8122761.0440.744292.7T/C783ATTTAGCCACCAGATCGTACTCTACTT
208BE404005_1_D_1001001SBEFORWARD732756.9329.638390.8T/C100CTTCAAACTATTGCAATCTATCATTAC
209BE404332_2_D_2712711SBEREVERSE3002763.6637.042181.95A/T271ACAAGAGAAGCATAGGGAAACAAAAGA
210BE404339_7_B_1281281SBEREVERSE1562662.934.624280.47T/C128ATTTGTGTGTTGTTTGCCTAGCATTA
211BE404339_7_B_1541541SBEFORWARD1272763.8133.336285.64T/C154AATTAATGCTAGGCAAACAACACACAA
212BE404339_7_B_2222221SBEREVERSE2512763.8440.746387.24T/C222ATCTGCAGTGTTGTTGAAAGGATGTAG
213BE404339_7_B_4874871SBEFORWARD4602761.2733.334393.69T/C487CATTTCTTACTTTCTGGTAATGCCTTT
214BE404339_7_B_6616611SBEREVERSE6902762.3833.335289.31T/C661AACCTGAAAAGTTCACCAATCAACTAA
215BE404341_5_A_2582581SBEREVERSE2872759.1237.045293.81T/C258CGTACAAAAGTGGTACTAAGATGTGTT
216BE404341_5_A_3333331SBEREVERSE3622760.133.333294.91G/C333TTTCACTCCTTTCAGTCTTTCACTAAT
217BE404341_5_A_3373371SBEREVERSE3662764.0640.743283.01T/C337ATGGTTTCACTCCTTTCAGTCTTTCAC
218BE404341_5_B_2612611SBEFORWARD2342760.7133.334395.38T/C261CTTTTGTATGTTTCTGCTCCTTAATTG
219BE404354_6_A_74741SBEFORWARD472758.1733.334290.33T/C74GAAGCATTTAAGATATTGACTTCAGAC
220BE404354_6_B_1121121SBEREVERSE1412760.5625.936092.06G/C112TAATTACAAACAAACAAACAAAATCCC
221BE404354_6_B_5735731SBEFORWARD5462760.0137.047399.33T/C573GCACCATTTCAGAAACTAACTCTTAAC
222BE404354_6_B_7807801SBEFORWARD7532760.8833.335395.49A/T780GATTAGCCGCTGTGTATAATTTTGTAA
223BE404354_6_B_7807802SBEREVERSE8082661.9442.315385.64A/T780GACTCTTCTAGCATACATCATGGGAA
224BE404374_3_A_6126121SBEREVERSE6412760.3237.045295.5T/C612AAAGGTCATCTCAGACAAGTGTAAATC
225BE404374_3_D_4004001SBEFORWARD3732760.6729.634192.15T/C400ATTTATATGCGTTCTGTTATTTGTTGG
226BE404374_3_D_4234231SBEFORWARD3962760.922.224289.43A/C423TTGGCTGAAGATTTCTATTTTTTTTTT
227BE404374_3_D_4234232SBEREVERSE4522758.9340.743292A/C423GTAGATGTGTCCTCTTTCTGTAAACTG
228BE404374_3_D_4454451SBEFORWARD4182761.6233.334290.98T/C445TTTTTCACAGTTTACAGAAAGAGGACA
229BE404468_4_A_2842841SBEFORWARD2582664.6442.314376.9A/T284GACATGCCTGCTGTTAAAACTTGTGT
230BE404468_4_A_2852851SBEREVERSE3142764.2637.045385.35G/C285TTCAAAGGCAGCAACATATTATTAGGG
231BE404468_4_A_3133131SBEFORWARD2862763.9237.045183.02T/C313ACCCTAATAATATGTTGCTGCCTTTGA
232BE404468_4_A_3133132SBEREVERSE3422763.837.043283.79T/C313CAAAACAAAAGTGCCAGAGAAACAGTA
233BE404468_4_A_4604601SBEFORWARD4342663.25504381.09T/C460GTATGCGACACTCCTTCTGACCTAGT
234BE404468_4_A_4604602SBEREVERSE4892756.5329.636185.01T/C460TTAAACTAAACTAGTAATTGGATGGTG
235BE404490_5_A_4724721SBEFORWARD4452758.1633.335392.59T/C472CAAAGTATGATGCTAGTCTAATGACAA
236BE404490_5_A_4724722SBEREVERSE5012759.3629.636396.82T/C472TATTGGCTGACCTATATAACAAAACAA
237BE404490_5_D_2972971SBEREVERSE3262757.9233.334289.6T/C297GAAAAGTAGAGTAGGTTCAAACAGAAA
238BE404553_4_A_1091091SBEFORWARD832664.5938.466276.66G/C109TGCCAAAGAACAAATACTTGAACAGC
239BE404553_4_A_1091092SBEREVERSE1382755.4125.935282.68G/C109TGAAACTTTTAGTATGAAATATGAGTG
240BE404553_4_A_3463461SBEREVERSE3742659.8434.624390.37T/C346CATCCAGATTTGTTTCATGTAGAACT
241BE404580_2_B_1591591SBEFORWARD1342564.57444268.79A/C159GCTTCGCAAGTTCTAAAGGAAAAGG
242BE404580_2_B_3003001SBEFORWARD2732762.3533.337290.66T/C300ATAAACCGTTGATAGCCGAAATCTAAT
243BE404717_4_A_1751751SBEFORWARD1502561.03446280.66T/C175AGGTACTGACATGTGGTGAGGAATA
244BE404717_4_A_2802801SBEFORWARD2542663.1834.627383.16T/C280ATTGCAGTTGTCAACAATCAGCTTTA
245BE404717_4_A_2802802SBEREVERSE3072564.86483267.3T/C280ACATCCTTCTCACTGTAATCAGCCG
246BE404886_2_B_3683681SBEFORWARD3412764.6533.336384.81T/C368TACTAATGGGCATTCATTTTGATGCTT
247BE404912_6_B_4884881SBEFORWARD4632562.74445274.91G/T488GGGTGGGCTTTACTTTGTAACTGAT
248BE404947_6_A_2472471SBEREVERSE2742564.71484370.03T/C247AAGATGCACTCACACCTTCCTCTGT
249BE404947_6_B_1051051SBEREVERSE1322563.06404375T/C105AATTATGCCCTCAACAGTATCAGCA
250BE404947_6_B_1191191SBEREVERSE1462560.45365281.79A/T119CATGAATCAGTATCAATTATGCCCT
251BE404947_6_B_1331331SBEFORWARD1082563.06444375T/C133GCTGATACTGTTGAGGGCATAATTG
252BE404947_6_B_2022021SBEREVERSE2312762.3640.743389.81T/C202CTCACTGCTCTCATCATCTACAAAAGA
253BE404947_6_B_2122121SBEFORWARD1862661.1342.313183.49A/C212GAGGAAGGTGTCAGTGTATCTTTTGT
254BE404947_6_B_2122122SBEREVERSE2392564.36483370.46A/C212CAACTCTGCTCACTGCTCTCATCAT
255BE404947_6_B_2692691SBEFORWARD2422761.4844.445393.68A/T269CCTGAGGTCCTTATCTGAATCTACTGT
256BE404947_6_B_3023021SBEFORWARD2762660.7738.468391.03T/C302GTTACTAGTGACTATGCCATGCAAAA
257BE404947_6_B_3023022SBEREVERSE3312761.8840.743187.89T/C302AGAGACGAAGACCAATCTGTAGGATAA
258BE404947_6_B_3113111SBEFORWARD2852663.4338.465279.5A/C311GACTATGCCATGCAAAATGTTATCCT
259BE404947_6_B_3173171SBEFORWARD2922560.47364382.75A/T317CCATGCAAAATGTTATCCTACAGAT
260BE404947_6_B_3773771SBEREVERSE4062764.2237.043384.22A/T377AGAAGTAAAAGTGGTCCGAAAATGTCA
261BE404947_6_B_4314311SBEFORWARD4042762.9440.748289.5T/C431CTCTACAGCCATTTAAATTCGTACCCT
262BE404947_6_D_1161161SBEFORWARD892762.2540.745391.37T/C116ATACTGACAACTTGGAATCTCTGGAAG
263BE404947_6_D_1161162SBEREVERSE1432563.59366374.64T/C116GATCTCCAGCAATTTTTGGTTCATT
264BE404947_6_D_1261261SBEREVERSE1552760.2633.334396.71A/C126CATTAGATAGTTGATCTCCAGCAATTT
265BE404947_6_D_4174171SBEREVERSE4462762.0437.046392.63T/C417AATTCACATACCTATGCAACTGACGTA
266BE404947_6_D_4554551SBEREVERSE4832663.1442.316281T/C455ATCGATGCAGAGAAGTAAAAGTGGTC
267BE404955_7_D_2562561SBEREVERSE2852756.3925.933284.39G/T256TCAAAACAAATGAATAATAGAGGATAC
268BE404977_4_A_50501SBEFORWARD232764.9848.157181.11T/C50GTAGCTGCTAAGGCAGAAGAAAAGAGG
269BE404977_4_A_50502SBEREVERSE792763.8344.446387.25T/C50TCAGACCACTGAATGTACAATAGCTCC
270BE404977_4_A_1151151SBEREVERSE1442761.8729.635392.51T/C115GAAAAATGGAAAATGACATAAAGCAGT
271BE404977_4_A_1281281SBEFORWARD1012758.6933.336394.82T/C128TTCTTAAGGTAACTTCACTGCTTTATG
272BE404977_4_A_1281282SBEREVERSE1572762.325.933288.32T/C128TCAAAGTCAAAGTGAAAAATGGAAAAT
273BE404977_4_B_99991SBEFORWARD742563.59407273.61A/C99CCAAATGATTTAACCCTGAGATGCT
274BE404977_4_B_99992SBEREVERSE1272664.146.156278.11A/C99CTACTCGAGCACGAAGCGTCTAAATA
275BE404977_4_B_2272271SBEREVERSE2562761.8625.933289.61G/T227AAAAGTCAAAGTGAAAAATGGAAAATG
276BE405045_2_A_2462461SBEREVERSE2732563.91485373.06T/C246CACGCTGCATGTCTTCGTAGTAAGT
277BE405059_7_D_51511SBEREVERSE802756.533.336388.26A/T51CTTAGTTTCATAAGCTTTCAGTAACAC
278BE405208_3_D_2412411SBEFORWARD2142759.9733.335398.02T/C241AAAATAGGTGAAACATAATGGAGTGTC
279BE405232_1_B_3813811SBEREVERSE4082561.71446380.3T/C381CTATGACTAACTGGCCAACAGATGA
280BE405269_4_D_1981981SBEFORWARD1712757.6129.634288.65A/T198TTTTTGTATTTCTAGGCTCAACTAACT
281BE405269_4_D_1981982SBEREVERSE2272762.737.044186.06A/T198AAACTACCAGACATGCAACGAAATAAC
282BE405269_4_D_6476471SBEFORWARD6212660.3538.464389.77T/C647TGATAACTGCATCATTGTACTGTCAC
283BE405269_4_D_6476472SBEREVERSE6762761.7240.745189.63T/C647CAGAAAGAAATCTGTAACATAGGAGGG
284BE405275_4_B_1911911SBEREVERSE2202760.3333.335295.47G/T191TCACAAGATGAGTGTGAACTATGATTT
285BE405275_4_D_51511SBEFORWARD242760.3529.637398.32T/C51ACATGAATTATGAATGTCTGGAAGAAT
286BE405275_4_D_51512SBEREVERSE802761.1244.445394.77T/C51AAGCTATGAGACCGATAGTACCCTAGA
287BE405371_4_D_74741SBEREVERSE1032763.5733.336388.03T/C74TCATATTTATTGATCATCTCCACCCAA
288BE405483_7_A_2412411SBEFORWARD2142760.9540.748397.14T/C241TACATGTAAGAGATGAACTCACTGCAC
289BE405483_7_A_5235231SBEREVERSE5522764.7240.746282.92T/C523CAGGGCAAGTAAATATAACTGCAAACG
290BE405496_3_B_1491491SBEREVERSE1782757.5329.634390.1T/C149TTACAACACATCTACAAATAACTCGAT
291BE405496_3_B_1531531SBEREVERSE1832859.0132.146389.1G/C153CGATGTTACAACACATCTACAAATAACT
292BE405496_3_B_1711711SBEFORWARD1442753.5425.936277.71T/C171AAATAGTATCGAGTTATTTGTAGATGT
293BE405509_3_B_2672671SBEFORWARD2392855.7821.437380.03T/C267CTTCGTTATATTTAAAATTGATGTGTAT
294BE405509_3_B_2672672SBEREVERSE2962760.2633.334396.71T/C267CAGAATATGAATGCTCTAAACCAGAAT
295BE405509_3_B_3233231SBEREVERSE3522757.8437.043288.72A/C323TACAAAACCACTAACACAGAGTAGAGA
296BE405509_3_D_2192191SBEFORWARD192276037.044295.83A/C219TTGATGTGTATCAGTTCTGGTTTAGAG
297BE405518_1_A_36361SBEFORWARD92764.4440.745283.12T/C36GATTTGATACACTTTGGTCACCTCCAT
298BE405518_1_A_36362SBEREVERSE632564.38404371.01T/C36ACGTTTCAAGCCATTTGGAGTATTG
299BE405518_1_A_45451SBEREVERSE722562.46366378.02T/C45GATACATGAACGTTTCAAGCCATTT
300BE405518_1_A_1061061SBEFORWARD792761.733.335189.7T/C106ATGGGAGTTCTTATTTAATCTTTCGGT
301BE405518_1_A_1061062SBEREVERSE1342664.4842.314174.06T/C106CTCTCACGCCTAACAAAACATATCCA
302BE405518_1_A_2502501SBEREVERSE2792760.3329.633294.2A/T250AGAAAACAGAATACAAAACAAAACTGC
303BE405518_1_D_2162161SBEFORWARD1912562.1484377.87G/C216CAGAAGCCGTAGTTACAGGTATGCT
304BE405518_1_D_2642641SBEFORWARD2372761.733.335393.01T/C264TGGGCTTTTTACTCAATAGTTCTGTTT
305BE405518_1_D_2642642SBEREVERSE2922660.6934.624287.08T/C264AGGAGGAAATATGAGAAAACAGAACA
306BE405519_4_B_3983981SBEFORWARD3712761.1633.334292.34T/C398CAGGTTTGTAGCTTTTTGTTTAGTTCA
307BE405519_4_B_5015011SBEFORWARD4752664.838.466174.36A/C501TTGCTGTTTCTGGAGCTCTTTTCTTT
308BE405519_4_D_3903901SBEFORWARD3632759.8133.334396.93T/C390TATGAAACCAGGAATCTAGGAGAAATA
309BE405519_4_D_3903902SBEREVERSE4192763.6633.336283.89T/C390AAAAAAGAGCTCCAGAAACAGCAAATA
310BE405519_4_D_5045041SBEFORWARD4772760.229.636296.49A/C504TTTGGTTATAAAATGTGTCTCACAGAA
311BE405597_2_B_1051051SBEFORWARD792664.7130.774171.06A/T105TGCTGTTTTTGCATTTTTTAGGTTGA
312BE405597_2_B_2092091SBEFORWARD1832661.5234.623281.69T/C209GGATGGGCTAAGAACAAAAAATAAAG
313BE405599_3_B_8478471SBEFORWARD820275733.335389.11G/T847TTACTTATGATACCCTTATGTGTTGTC
314BE405604_2_A_7847841SBEFORWARD7572762.7940.746288.71A/C784GTAGCTTTATACCGGTGCTTTATCCAT
315BE405604_2_A_8698691SBEREVERSE8982762.4337.047290.41A/C869TTGCAAGGTAATCTTGGCACTACTTAT
316BE405604_2_A_109710971SBEFORWARD10702756.0733.336285.28T/C1097TCTCTACATAGACTTATTTTAGGAACG
317BE405604_2_A_109710972SBEREVERSE11262759.8737.045194.39T/C1097CTTTGACTGAATTTCTATTGTACTCCC
318BE405667_5_B_3043041SBEREVERSE3332762.5233.335390.56T/C304ATCAGTAAACATGCTGCCTCTTAAAAA
319BE405667_5_B_3803801SBEREVERSE4092760.4229.638297.08T/C380AGTAGTTAACCACACAAATTCCAAAAA
320BE405749_1_B_2312311SBEFORWARD2042761.1133.334394.16T/C231TTTTCTTTGGATACAGATGAGATGAAG
321BE405809_6_D_3243241SBEFORWARD2992561.2484278.9A/T324ATGGCTAGTTCTCTGGTGATACTCC
322BE405809_6_D_3243242SBEREVERSE3522664.1346.154378.44A/T324GAGTCCATAAAGAGGGATCTGGAGAA
323BE405809_6_D_4134131SBEFORWARD3882564.52444370.62T/C413GACATTATCGACATGCTTTAGCCGT
324BE405809_6_D_5205201SBEFORWARD4932759.8629.634397.09G/T520TGCACAAGCATATCTGTATTATTTTTC
325BE405809_6_D_5205202SBEREVERSE5492761.2533.336293.35G/T520GATAAAGGATTTTATGTTTAAGGGGCT
326BE405834_1_B_2162161SBEREVERSE2432563.32486375.45A/C216AGACGCTTCTTTGAGGACTGTATCC
327BE405834_1_B_5755751SBEFORWARD5482758.6744.447293.72T/C575ACAGACTCTACAGTAGGAAGTACAACG
328BE405835_7_A_2422421SBEREVERSE2712759.4133.334294.05T/C242AAGGCCAGTTAAAGCATAAATACATAC
329BE405835_7_B_1661661SBEFORWARD1392762.8837.045287.82A/T166TCTTGATTTAAGCCTGATACGCTAATG
330BE405835_7_D_43431SBEFORWARD162759.6633.335397.1T/C43CTCTTGATTTAAGCCTGATATGCTAAT
331BE405849_5_A_1791791SBEREVERSE2082760.7133.335396T/C179ATCTGGTCAAGAGAAAACAGAATATGA
332BE405849_5_B_2652651SBEREVERSE2942760.0637.045397.93T/C265TACAAGTTACAAGAACAAACTGAGTGG
333BE405849_5_D_1291291SBEREVERSE1562563.78444271.15T/C129CCTTGGTATAAGTGTTTGGGAATGC
334BE405849_5_D_1361361SBEREVERSE1652760.2537.045194.03T/C136AGTTACTTGCCTTGGTATAAGTGTTTG
335BE405849_5_D_1401401SBEREVERSE1692760.6440.745396.21A/C140GATGAGTTACTTGCCTTGGTATAAGTG
336BE405849_5_D_1911911SBEREVERSE2202760.2833.335397.29T/C191AATCTGGTCAAGAGAAAACAGAATATG
337BE405849_5_D_2422421SBEFORWARD2162657.5730.777283.76T/C242GATTTTTAACTTACAATCTGTCATCG
338BE405849_5_D_2602601SBEREVERSE2872564.45483268.54T/C260TCAGGAACTCACCTTTCTTCTCAGC
339BE406148_7_B_1831831SBEREVERSE2112663.5434.626279.79T/C183CAAATTTTATTCCAATAGCCAGCCTT
340BE406148_7_B_2372371SBEFORWARD2102761.2137.044393.88A/T237GCTCTATACAATCACAGTTGCTTTGTT
341BE406148_7_B_2372372SBEREVERSE2662758.5829.638395.73A/T237CTAAATTACTTTAAGATGTGAGCCAAA
342BE406148_7_B_2542541SBEFORWARD2272764.9433.333178.71A/C254TTGCTTTGTTATTTTGGCTCACATCTT
343BE406148_7_B_6476471SBEFORWARD6202762.3833.338288.22G/C647TCTACCATGGTTCTAAAAAAAATCCCT
344BE406148_7_B_6476472SBEREVERSE6762764.5137.044383.96G/C647ACATTCATATTTGGGCACTTGTATGGT
345BE406351_2_A_4364361SBEREVERSE4632561.22328383.01A/T436CAATAACATTCGAACGTGGAATAAA
346BE406351_2_B_4054051SBEFORWARD3792661.3430.776388.05T/C405CATTGTAATGCTATTGCGTGTTTTTA
347BE406351_2_B_4054052SBEREVERSE4342752.9422.226377.57T/C405CTAATCATGAAGTAGTAATTTAACAAA
348BE406509_2_A_2352351SBEFORWARD2092664.6742.314275.16T/C235TCAAGCTATGTATATTGTGGGACGGA
349BE406509_2_A_2352352SBEREVERSE2642760.2540.744396.74T/C235ACAGGATGTGTACTGAAAAACCTACTC
350BE406509_2_A_3663661SBEFORWARD3392754.9522.227282.57T/C366ATTAACAGATAGTATCAAACAAACAAA
351BE406509_2_A_4054051SBEREVERSE4322564.5486371.91G/C405CAATTGAAGCAGTAGAACTAGCGCC
352BE406509_2_A_5875871SBEFORWARD5602759.4637.044294.21T/C587ACTATTAACTTCAGGTGATTCTGGTTC
353BE406509_2_A_7287281SBEFORWARD7022664.546.154275.67T/C728CTGCTTTAGGTATATGTTGGTGGGCT
354BE406509_2_A_7287282SBEREVERSE7552563.53444271.91T/C728AGCTCGTCTTCACTAACATTTGGGT
355BE406509_2_D_1641641SBEFORWARD1372757.8537.045188.34T/C164CTGTCGTAGTGTTCTCCTATTAGTTTT
356BE406509_2_D_1641642SBEREVERSE1932762.6533.336390.79T/C164TTCTTCATTAAAAACAGGATGTGTTCC
357BE406509_2_D_2162161SBEFORWARD1892761.7433.335291.23T/C216AGAATGGTGCTTTCTTCTGTTATTGAT
358BE406509_2_D_2162162SBEREVERSE2452761.1433.334190.74T/C216CAGAAAGGCAAAACAAGTACAGATAAA
359BE406509_2_D_2732731SBEFORWARD2462756.8837.047390.02T/C273ACTACGTACATGACCTGTAGAGATTTA
360BE406509_2_D_5555551SBEREVERSE5842763.3544.446287.05T/C555ACTATGGAAACACCAGTATACACACCG
361BE406509_2_D_6126121SBEFORWARD5852761.5829.636394.01A/C612TTTGTTAACCTTGTGGCTTTTTAGTTT
362BE406516_1_A_2212211SBEREVERSE2502759.0333.332291.66A/T221AGTGGGATTGTGTATGTGTATGTTTAT
363BE406516_1_A_2342341SBEREVERSE2632759.0333.332291.66A/T234AGTGGGATTGTGTATGTGTATGTTTAT
364BE406516_1_D_4834831SBEFORWARD4562763.3437.044387.47T/C483TTGCCATTCACTATACAGAGCTTCAAT
365BE406609_5_A_1811811SBEREVERSE2102762.6537.046187.45A/C181AGACTCGGTAAACCAAGAATCCTAAAA
366BE406609_5_A_2042041SBEREVERSE2322655.6934.627379.79T/C204ATCTGATAATGACTAACACATGAGAC
367BE406609_5_B_53531SBEREVERSE822759.8833.334397.13T/C53ATCTTTGTGCTATGCTATGTGATATTG
368BE406617_4_B_94941SBEFORWARD692557.87405276.75T/C94AGATGATATAGCCCATTCACTGTAG
369BE406877_5_A_91911SBEREVERSE1202763.7540.744386.25T/C91AAAGCATCCCTACATGGACTCATAAAG
370BE406877_5_A_93931SBEFORWARD662761.6529.638293.39T/C93TGTTGAAATTTCTGTTAGTTGATTTGG
371BE406877_5_A_93932SBEREVERSE1222762.2137.044390.88T/C93ATAAAGCATCCCTACATGGACTCATAA
372BE406877_5_A_1061061SBEREVERSE1332563.03403272.8T/C106ACCCATAAAGCATAAAGCATCCCTA
373BE406877_5_A_1071071SBEFORWARD802762.3133.334390.58G/T107TTAGTTGATTTGGCTTTATGAGTCCAT
374BE406877_5_A_1551551SBEREVERSE1822551.16207359.53T/C155CAATAAACATATTATGAAATTCTCT
375BE406877_5_A_2232231SBEFORWARD1962760.9437.046294.26G/C223ATCATGCATACTTCCATAGTTTCACTC
376BE406877_5_A_3213211SBEREVERSE3492663.4142.315279.56T/C321AGCTGTTTGTGATGTCAGCATGTAGT
377BE406877_5_A_3493491SBEREVERSE3782764.2344.446182.74G/T349CTAAAATACTTTCCACTGCACTCCACC
378BE406877_5_A_4494491SBEREVERSE4782757.0933.334287.1T/C449ACTGAAAACTAGAGATAAAGATATGGC
379BE406877_5_B_4384381SBEFORWARD4102859.7335.716187.94G/C438GCTATATCACAGGTGAGCTAAGTAAAAA
380BE406877_5_D_48481SBEREVERSE772761.6140.748395.17T/C48GAAATTTCAACATACCGCTAGTCCTAC
381BE406877_5_D_96961SBEFORWARD692763.4629.638389.61T/C96GAAATTTCTGTTGGTTGATTTGGTTTT
382BE406877_5_D_96962SBEREVERSE1252760.6637.044395.52T/C96AAGCATAAAGCATCCCTAAATAGACTC
383BE406877_5_D_1181181SBEFORWARD912758.7633.334292.11T/C118GTTTTATGAGTCTATTTAGGGATGCTT
384BE406908_2_A_2162161SBEFORWARD1892759.8544.446296.63T/C216CTCCTAGATACTGAGGATATGTCAACC
385BE406908_2_A_2162162SBEREVERSE2452759.0329.634394.6T/C216GGTGTTCTTGTTATTGTTTGAATTAGA
386BE406908_2_A_3883881SBEREVERSE4172758.3337.044290.82T/C388AGAGAATAGCGGATACCTTTTTAGTAG
387BE406943_7_A_3133131SBEFORWARD2862758.5129.638293.87T/C313ATCAGATATCCGAATTATCTATGTTCA
388BE406943_7_D_4414411SBEFORWARD4142762.1737.045391.62T/C441TAACATTCACCATTACAGTCTGAGGAA
389BE422566_4_A_7857851SBEFORWARD7582764.0337.044283.75A/T785GAAGATGTTGTGCCTGAAAATAAAACC
390BE422566_4_B_7737731SBEREVERSE8012663.2634.628281.88A/C773AATGAACAAGATCTTTGCAACTGTGA
391BE422567_4_A_1111111SBEFORWARD842763.5433.334386.87G/C111TTTTTCAGGGATGTTCTGATTTTCTCT
392BE422567_4_A_1111112SBEREVERSE1382564.93444267.72G/C111TAATTTTATTCAGGGTGTACGGGGC
393BE422567_4_A_3503501SBEFORWARD3232764.7144.446282.95A/C350TGTTCTGTAAAGCACTGAACCCTAACC
394BE422939_6_D_45451SBEFORWARD192660.0838.465391.21T/C45GAGAAACAGACTATTGCATTCAGGTA
395BE422939_6_D_45452SBEREVERSE742758.2133.336393.38T/C45GTATACACATTCGTGTTCTTCCTAAAT
396BE422939_6_D_80801SBEREVERSE1092762.2233.334390.83T/C80CAGGGTATAATGTTTGGGAAATAACAA
397BE422939_6_D_2152151SBEFORWARD1902564.77485370.49A/T215GGTAGTGGCGTTGAAGTCACAAGTT
398BE422939_6_D_2262261SBEREVERSE2542660.2538.466391.33A/C226GAACCATTTCTGATATCTCCTCTGTT
399BE422939_6_D_2272271SBEREVERSE2562762.5337.046289.49T/C227TTGAACCATTTCTGATATCTCCTCTGT
400BE422939_6_D_2402401SBEFORWARD2132763.3337.046388.77A/T240TTTGTTTCATGTACGAACAGAGGAGAT
401BE422939_6_D_2542541SBEFORWARD2282660.2538.466391.33T/C254AACAGAGGAGATATCAGAAATGGTTC
402BE422939_6_D_2542542SBEREVERSE2822664.734.625275.69T/C254AAATGTCAATTCAGAACCAACACCAA
403BE422939_6_D_3393391SBEFORWARD3122760.9437.044394.69T/C339AGTACCAAAAGTAATGCGGTCTAAACT
404BE422939_6_D_3393392SBEREVERSE3672659.3642.315389.53T/C339AGTAGCCAGACAGTTTTGTGATACTC
405BE422939_6_D_3853851SBEFORWARD3582762.1144.445391.79G/C385CTGGCTACTGATTACCCTACAAGTCAT
406BE422939_6_D_3993991SBEFORWARD3732661.0746.154387.62G/C399CCTACAAGTCATCACACTACCATGTC
407BE422939_6_D_4004001SBEFORWARD3742661.0746.154285.96T/C400CTACAAGTCATCACACTACCATGTCC
408BE422939_6_D_4354351SBEFORWARD4082760.237.048399.4G/T435ACGCTAATTAGTACCGCATATTCATAG
409BE422939_6_D_4354352SBEREVERSE4632660.7530.774388.58G/T435GAAAATTCAACACGCCATCTATTATT
410BE422939_6_D_4534531SBEFORWARD4262758.9333.336293.87A/T453TATTCATAGGTAATAATAGATGGCGTG
411BE422954_7_D_1941941SBEFORWARD1672760.1633.337398.9T/C194AGTAATGACTCATATTTTGCAGGATTC
412BE422954_7_D_1941942SBEREVERSE2232755.7729.636284.38T/C194ATAGATTCAGTTAGTATAATTGTTGGC
413BE422954_7_D_3583581SBEFORWARD3322661.530.776387.59T/C358CAAAACTGAGCATCATTAATCAACAA
414BE422954_7_D_3583582SBEREVERSE3872763.748.154386.4T/C358ACACACCTAGACGGAGAGAATACCTGT
415BE422954_7_D_3673671SBEFORWARD3402761.3633.336293T/C367AGCATCATTAATCAACAAGAACAGGTA
416BE422954_7_D_3673672SBEREVERSE3962764.4851.854282.38T/C367AGCTGACTTACACACCTAGACGGAGAG
417BE422954_7_D_3703701SBEREVERSE3992763.1648.157186.55T/C370GTAAGCTGACTTACACACCTAGACGGA
418BE422954_7_D_4684681SBEFORWARD4412760.2137.042293.94A/C468CTTCTATCTCGTTTCTTGTTTCTTGAC
419BE422954_7_D_4684682SBEREVERSE4962664.1542.313377.76A/C468ACACCCCTCATCTCTTATTGGTTGAT
420BE422954_7_D_5405401SBEFORWARD5142661.1642.314387.36T/C540GAGACTACCAAACACAATATGCAGTG
421BE422954_7_D_5505501SBEFORWARD5232761.1933.334393.93T/C550AAACACAATATGCAGTGGTTAGTTCAT
422BE423455_4_A_4534531SBEFORWARD4262764.8637.044382.91T/C453ATACTCCTTGCCATCCTTTTATTGCAT
423BE423455_4_A_4534532SBEREVERSE4812662.1834.624282.63T/C453GGTTAATCCACACACAAACAACAAAT
424BE423455_4_B_2112111SBEREVERSE240276337.046389.74A/C211GAGTAATTTTAGCAACTGCAGCACAAT
425BE423455_4_B_8068061SBEFORWARD7792754.2229.636178.06A/T806AAGGTCTAACATGATATAGAGTACAAA
426BE423455_4_B_8068062SBEREVERSE8352754.9929.633280.17A/T806TACTGTTCTTCACTCTGTTGTATTATT
427BE423871_1_B_1901901SBEFORWARD1632762.9440.744185.35T/C190TTCTCTACCATCTTCACTATGATTGCC
428BE424100_1_D_1931931SBEFORWARD1662759.3329.635396.13T/C193TCCATAGTGAATTGAAGTGTTTATGTT
429BE424174_7_A_2312311SBEFORWARD2052664.1142.314276.85T/C231CTGAAATTGTGGCTCAGATAACCAAC
430BE424174_7_A_2312312SBEREVERSE2602756.2529.638388.74T/C231GAGCAAAATCTAGATAACAAATGTAAC
431BE424174_7_A_2332331SBEFORWARD2062763.9937.044283.87G/C233TGAAATTGTGGCTCAGATAACCAACTA
432BE424174_7_A_2332332SBEREVERSE2632859.5732.148392.06G/C233GGAGAGCAAAATCTAGATAACAAATGTA
433BE424200_3_D_5225221SBEREVERSE5492564.72366371.27G/C522AACGGAATTCGTGTGAACAAAACAT
434BE424200_3_D_6146141SBEFORWARD5872757.4725.937290.12T/C614ACATGATTCTTGTATTTATTTTTCCTC
435BE424246_3_B_1271271SBEFORWARD1022563.27484374.37T/C127CTCCCTATGAAACAGCACATACTGC
436BE424391_7_A_77771SBEFORWARD502760.0729.634295.61T/C77AAAGAAAGATTAAGGAAAAGAAAGTGC
437BE424391_7_A_1971971SBEFORWARD1702763.2640.744387.72T/C197AATGTGTACTTAGCTGTTGCCATCCTA
438BE424391_7_A_2512511SBEREVERSE2802760.5133.335396.59G/T251TATGGAACAGTTTAGAACCAATTCACT
439BE424391_7_A_2672671SBEFORWARD2402764.8444.448385.47A/T267CAGGACTCACGTAAGTGAATTGGTTCT
440BE424391_7_A_2672672SBEREVERSE2942563.91445373.05A/T267ACATGATGCAGGTGTATGGAACAGT
441BE424391_7_A_2682681SBEFORWARD2412762.5740.748290.63A/T268AGGACTCACGTAAGTGAATTGGTTCTA
442BE424391_7_B_331SBEREVERSE312661.7938.464385.47A/C3CCATTACAAACACAGAATATGCACAG
443BE424391_7_B_551SBEREVERSE322561.78404378.83T/C5GCCATTACAAACACAGAATATGCAC
444BE424493_4_A_2172171SBEFORWARD1902762.1537.045391.69G/T217GATCACACTGTTTCTCAAGTCTTTCAA
445BE424493_4_A_2172172SBEREVERSE2462758.7429.634391.51G/T217GCAATATCAATCTCGTAGTATTTTTTG
446BE424493_4_D_2772771SBEREVERSE3042563.72443169.04T/C277GGCATCAAATCTTACCGTGCTTACT
447BE424523_6_D_2982981SBEFORWARD2712758.4129.636393.98G/T298GTCAATAAGAGCATATAGATTTTGCAT
448BE424523_6_D_2982982SBEREVERSE3252564.33403370.56G/T298AACGATTTGGAAGGAATGGAGTCTT
449BE424523_6_D_4864861SBEFORWARD4592757.6529.633288.17T/C486ACTTTCAATAAGCATCCAAATACTAAC
450BE424523_6_D_4864862SBEREVERSE5152762.8725.934183.34T/C486TCATTTTTTCATTTGCATTAGTTTGGT
451BE424593_4_B_1071071SBEREVERSE1342561.9365277.41T/C107ATTCACTGCATCATCATCCTACAAA
452BE424826_7_B_1821821SBEREVERSE2092562.52366377.86G/C182CAGGAAATTGTTCAATCTATTCGGA
453BE424826_7_B_3623621SBEREVERSE3912752.1222.225272.83A/C362ATAAAAGCTAGTAACTCATAATAACAA
454BE424826_7_B_6546541SBEFORWARD6272760.3829.634396.35G/T654ATCAGTTTTTATTCTGCTCTTGAATTG
455BE425120_7_A_3093091SBEFORWARD2822764.5544.447385.73T/C309ATCAGTTGTACTGCAACCCAGGAATAC
456BE425146_4_A_3753751SBEFORWARD3502550.11286355.76T/C375CTATATTATTCCTCAATTCTATACC
457BE425146_4_B_1991991SBEREVERSE2282759.3529.634395.55T/C199GAAGAACATACCAAAGAAAACGATTAT
458BE425146_4_B_3953951SBEREVERSE4242762.2237.044289.16G/T395AAACTTGTCAGTGGTTTGCTACACATA
459BE425146_4_D_2052051SBEFORWARD1792664.9246.154376.06T/C205ATGAGACCCCTTGGTGTTGGTTAGTA
460BE425161_5_B_2122121SBEFORWARD1852761.3637.044393.42A/T212CTTGACATATAGAAAAATGACACTGGC
461BE425161_5_B_2122122SBEREVERSE2412758.0337.046392.85A/T212TCTATAGTACGTAGGTGAGGGAATAAA
462BE425301_4_A_1601601SBEREVERSE1892763.7737.044383.98T/C160ACAGGTTAGCAAAGGAAAAAACACAAC
463BE425301_4_A_4274271SBEFORWARD4002761.9433.332184.87A/T427TCACCTTGCTCTTTTTTCTATCTGTTT
464BE425301_4_B_3793791SBEFORWARD3522759.0833.334394.74T/C379TAACAACTCTATCTGTGTTTCTTGCTT
465BE425301_4_D_1371371SBEFORWARD1102762.2540.744390.75T/C137CTCACAAACTTCTGGGTAATGATCTCT
466BE425830_4_A_1931931SBEREVERSE2222760.7525.932188.46G/T193AAAAAACAAAAGAAACAGCAAACTACA
467BE425830_4_D_2322321SBEFORWARD2052757.4625.934288.21G/T232TCTCAATTATGTTTAGATGTGATGTTT
468BE425879_1_A_4894891SBEREVERSE5182763.1837.043387.35T/C489AATAATGAATGGGTTTCCTACTCTCCA
469BE425879_1_D_5065061SBEFORWARD4792763.1837.043285.68A/C506TGGAGAGTAGGAAACCCATTCATTATT
470BE425919_3_D_6136131SBEFORWARD5882560.95404279.66G/C613GGAAAGGGTGTGTATTGTTTCTTCT
471BE425919_3_D_6136132SBEREVERSE6412662.9638.463279.68G/C613GTCAAGCAAAAGAAGCCCAATACTAA
472BE425919_3_D_6536531SBEFORWARD6262764.9637.043280.32T/C653CTTCTTTTGCTTGACATTCTTTCTGGA
473BE425919_3_D_6536532SBEREVERSE6822759.5729.634396.2T/C653TGCATCTTACACTTCATTATTTTCTGT
474BE425978_1_D_53531SBEFORWARD272664.6238.466174.89T/C53CTGTCTTGTTCATGCATTTTCCATCT
475BE425978_1_D_1281281SBEFORWARD1012760.7837.044395.15T/C128GCATTCTGTTACTGCACTTGATATGTA
476BE426016_4_A_1681681SBEREVERSE1972751.8625.936374.33T/C168AGTATAATATCAAACATCTCAAGTAAC
477BE426016_4_B_6286281SBEFORWARD6002858.5339.296286.01G/C628TGTACTCTAGTGCTAGTCTAATGCTGTT
478BE426016_4_D_5395391SBEREVERSE5682754.5825.934177.89T/C539AGCACTAGAGTACAAAAATATAAACAA
479BE426080_5_D_5855851SBEFORWARD5602563.87446272.15T/C585CTGCAGAATACCACAAAATAAGGGG
480BE426214_6_A_4444441SBEREVERSE4732758.325.934392.41T/C444TTTTGCTATTGTTTTCTTGTTCTAACT
481BE426214_6_A_4654651SBEFORWARD4382754.6622.225280.43T/C465TTAGATTAAGTTAGAACAAGAAAACAA
482BE426214_6_A_5935931SBEREVERSE6222761.729.633391.77T/C593ATCATCTGTTTGTCTTGTTTTTGAATG
483BE426214_6_A_6226221SBEFORWARD5952761.729.633391.77T/C622CATTCAAAAACAAGACAAACAGATGAT
484BE426214_6_A_6226222SBEREVERSE6512754.9522.227384.23T/C622TTTTACAATCTGTCTGTATTGTTATTT
485BE426214_6_A_6236231SBEFORWARD5962761.729.633290.1T/C623ATTCAAAAACAAGACAAACAGATGATG
486BE426214_6_D_1051051SBEFORWARD802563.7445170.37T/C105AGGAGATGTTGAATCCACGGTAAAG
487BE426214_6_D_1051052SBEREVERSE1342763.3444.445388.1T/C105AGACTCTCAAGTCAGATGGTATTGCTG
488BE426214_6_D_3763761SBEREVERSE4052756.2425.936387.48T/C376TTCTAACTTGATCTAATTCATTTGTCT
489BE426214_6_D_4314311SBEFORWARD4042757.422.223389.08A/T431ACAAGAAAACAATAGCAAAAGAATAAT
490BE426214_6_D_4314312SBEREVERSE4602757.8633.336392.34A/T431TACAGCTTATGCTAGTTTTATGTACCA
491BE426214_6_D_4324321SBEFORWARD4052756.7822.223387.22A/C432CAAGAAAACAATAGCAAAAGAATAATA
492BE426214_6_D_4324322SBEREVERSE4622858.1635.718387.81A/C432CATACAGCTTATGCTAGTTTTATGTACC
493BE426214_6_D_6206201SBEFORWARD5942660.1630.773288.07T/C620ATCAAGAGCATCATCACAAATAACAT
494BE426222_3_A_72721SBEFORWARD472563.27484272.7G/T72CCTGCATATACTTGTGTCTTCTGGC
495BE426222_3_B_1421421SBEFORWARD1142858.0832.144283.41T/C142GGGTAGATGAGGTACTAAAACTTAAAAA
496BE426222_3_B_1421422SBEREVERSE1712761.6433.335291.55T/C142TGATTCAATAACTTGATAATCTGTGGC
497BE426222_3_B_1911911SBEFORWARD1662564.3405371.89T/C191AATCACTGCTTTGCTGCTGTATTGA
498BE426222_3_D_2312311SBEREVERSE2602763.0529.636389.61T/C231TAACAAGCGATTTTGGTCAGAATTAAA
499BE426287_3_D_1131131SBEFORWARD872661.8538.464385.29T/C113ATTTTGGTGTGTCGATGAATAGAGAG
500BE426317_4_A_1681681SBEREVERSE1962664.7342.316377.89T/C168GAATTCTATGGCTGGTCGATGAGATT
501BE426317_4_B_3943941SBEREVERSE4232764.2337.046386.07T/C394AAACATATGATCAGAATCCCCATGAAC
502BE426413_6_A_3983981SBEFORWARD3712759.433.337397.57T/C398AAGTTAAGTTTCAATCTTGTCTCGACT
503BE426413_6_A_3983982SBEREVERSE4272762.9544.447187.2T/C398CTGTTGTAATCATATACACGTCCCTCC
504BE426413_6_B_1911911SBEREVERSE2202758.6733.335292.47A/T191TACTAAGTTTTCTGGTAATGTTGTGGT
505BE426413_6_B_1971971SBEREVERSE2262755.5129.636385.28T/C197AGCATATACTAAGTTTTCTGGTAATGT
506BE426413_6_B_2862861SBEREVERSE3152764.1237.044283.49G/C286TTAAAGCGAGATGCACACACAACTATT
507BE426413_6_D_5035031SBEFORWARD4782564.7445269.01T/C503CTATCCTGTGGTGCATGTCATTTTG
508BE426413_6_D_6716711SBEFORWARD6442762.1937.045188.21T/C671CACACAAGTCTTCACATCGTTTATTTC
509BE426418_3_A_6306301SBEFORWARD6032760.5733.336397.03T/C630CTAAATTTTCTCGTGACTGAATTATGG
510BE426584_1_B_2802801SBEREVERSE3072555.58326372.16T/C280CAAGAAGTAATCCATTAAAGCTAGA
511BE426584_1_D_4224221SBEFORWARD3972564485271.13T/C422GATACCCGACAAGTATTTCCAGACG
512BE426591_6_D_1041041SBEREVERSE1332757.3929.636286.65T/C104GTTACATATGCACTCTAGACAAAAAAA
513BE426591_6_D_2122121SBEREVERSE2412756.629.634285.62A/C212TGAAATGAGGTTACTTATAGATTTGAG
514BE426591_6_D_4404401SBEFORWARD4132758.7433.335292.68T/C440GAAACTAACTTATCCTGGTCATTTCTT
515BE426591_6_D_5435431SBEFORWARD5172663.242.314279.58T/C543GTCTTTGATGATGATTCCCTGGTTAG
516BE426591_6_D_8208201SBEREVERSE8472561.94403377.71T/C820CTTATGTTGTGGAAAGGAGAAGCAT
517BE426591_6_D_8218211SBEREVERSE8482564.69444268.44G/T821CCTTATGTTGTGGAAAGGAGAAGCA
518BE426620_2_D_56561SBEFORWARD302664.1346.158380.95T/C56GCAGTAGATGCGTATTTATGCTGGTC
519BE426620_2_D_56562SBEREVERSE842660.4430.778290.36T/C56ACCAAATTTGATTTTATCGACCTCTA
520BE426620_2_D_2832831SBEFORWARD2572660.4742.316390.67A/T283CTATAGTTCCCTCCGTTGCATAATAC
521BE426620_2_D_2832832SBEREVERSE3122764.9444.446383.94A/T283CCATAAGGCCATAACTATACCGTGTGA
522BE426721_6_B_6686681SBEFORWARD6412762.437.044186.98T/C668CTGATGTTTCGCTCTTCAAATTCTACT
523BE426721_6_D_89891SBEFORWARD622764.5533.336382.87T/C89TTTGAAAGCATCTTTTTTAGATGTGGC
524BE426721_6_D_2272271SBEREVERSE2562757.3225.935390.08T/C227TAATTGACATCAGTAGAATTTGAAAAG
525BE426721_6_D_2312311SBEREVERSE2602759.8633.336398.33T/C231CCTGTAATTGACATCAGTAGAATTTGA
526BE426801_1_B_4574571SBEFORWARD4322562.74483375.32G/T457GTAGAAGCCAAGGGCATAGAGTTTC
527BE438226_4_A_8248241SBEFORWARD7972757.4525.934288.17T/C824AATAATACTTCAAAATAACGACCATTC
528BE438226_4_A_8248242SBEREVERSE8512561.11367281.03T/C824TCATCATATTACAATGAACCAAGGG
529BE438226_4_B_6566561SBEFORWARD6292763.9240.743283.46T/C656CACCTCTTGCCCTGAATAAACTCTAAA
530BE438268_4_A_3413411SBEREVERSE3702759.333.334395.4T/C341CTGAACATGGACAAGATATAAAACATC
531BE438268_4_A_3563561SBEFORWARD3292760.9529.635395.27T/C356TTTGCGAAGATTCTGATGTTTTATATC
532BE438268_4_A_5185181SBEFORWARD4912763.8640.745386.54G/T518AACTTATTGATGATGCCTTAGGTGCTC
533BE438268_4_A_5185182SBEREVERSE5452564.54443268.24G/T518GTCAACTCCACCATTTGTCATCTCA
534BE438268_4_B_3213211SBEREVERSE3502755.2522.223280.96T/C321TAAAACATTAGAAACTACTCAAAACAA
535BE438268_4_B_3223221SBEREVERSE3512754.4222.223176.8G/T322ATAAAACATTAGAAACTACTCAAAACA
536BE438268_4_B_4614611SBEFORWARD4362558.33328381.65T/C461TTCTTCACATGAGGAAAATAGTTGT
537BE438296_5_B_93931SBEREVERSE1222759.7629.635397.39G/C93AAAATTATTGATGCTAGTGGTTGATCT
538BE438296_5_B_4104101SBEFORWARD3832758.7837.046395.09T/C410ACTAATATTCCCTTACTTCGCAGATAC
539BE438495_6_D_1851851SBEFORWARD1592663.1842.316382.55A/T185ATCTGACAGTGCTGTTTACCGTGATA
540BE438495_6_D_3293291SBEFORWARD3022759.0337.044394.59G/T329TTAGCTGTTTGCTCTAGTTCTGTTTAG
541BE438495_6_D_3293292SBEREVERSE3582762.433.335289.27G/T329AATTCAATACTCAAAGAGCCACAACAT
542BE438495_6_D_5335331SBEFORWARD5082562.85444273.95T/C533CAGGTAATGGTTAATCTTGTGGTGC
543BE438495_6_D_5625621SBEFORWARD5372564.01365271.1G/C562ACCTGCAACATTTGGAATTTGTTCT
544BE438866_1_A_26261SBEREVERSE552764.3640.747284.62G/C26ACATGCCATCAGTGATAAAGAAGAGGT
545BE438866_1_A_69691SBEREVERSE962562.72403273.71T/C69CACAAAACACCTGAACTCCAAGATT
546BE438866_1_A_1211211SBEREVERSE1482564.21445372.17T/C121ATTATAGCAGCAGGCACAGTGTCAA
547BE438866_1_A_1311311SBEFORWARD1052663.0442.315280.67G/C131GAAGCATTAACTTCACCCTTGACACT
548BE438866_1_A_1311312SBEREVERSE1582564.71446269.61G/C131AGCAATTGACATTATAGCAGCAGGC
549BE442567_3_B_1021021SBEREVERSE1312763.8437.045284.93G/C102CAACGCTCCAAATAGCTGTAATTTCTT
550BE442572_7_A_75751SBEREVERSE1042761.6333.334290.95A/T75CTGAAGTTTACCATGACAACAACAAAT
551BE442572_7_A_1981981SBEREVERSE2272760.1137.047399.05T/C198GAAAACCATGTACTGGACATAAACTCT
552BE442572_7_A_2922921SBEFORWARD2652763.9237.047285.94G/C292TGTTAGATTCTTACCCGACCATTGATT
553BE442572_7_A_3213211SBEREVERSE3502760.0237.045398.08G/C321TGTGCCAAATAGATAAGCTAGGTAAGT
554BE442572_7_A_3663661SBEFORWARD3392764.3737.047386.27T/C366TATTTGGCACAGTGCTTCATTGATTAG
555BE442572_7_A_3703701SBEFORWARD3432764.0237.047387.33A/C370TGGCACAGTGCTTCATTGATTAGTATT
556BE442572_7_A_3773771SBEFORWARD3502763.2640.745388.35A/T377GTGCTTCATTGATTAGTATTCTGTGCC
557BE442572_7_A_3773772SBEREVERSE4062764.4240.747386.1A/T377GTGATCCAGAGGAAAGTTTCACAAAAG
558BE442572_7_A_4114111SBEREVERSE4402759.8633.335397.7A/T411TCGATGACATACTCTAAACAATAATGC
559BE442572_7_A_5215211SBEREVERSE5502759.0737.046294.3T/C521TAAGTACAAAATCTAGAAGAGAAGGGC
560BE442574_6_D_1701701SBEFORWARD1442663.0238.466383.04T/C170GAAATTGTGAGGAAATCCTTGAGCTA
561BE442574_6_D_3733731SBEFORWARD3482564.7483267.77T/C373CCGCTACAGGGAAGTATGAGGATTT
562BE442574_6_D_4074071SBEFORWARD3812663.1942.317383.13G/C407CTGGTATTATTGATCCCACCAAGGTA
563BE442574_6_D_4264261SBEFORWARD4002664.7642.315377.19A/T426CAAGGTACGAGCAAATTGTGTTTACG
564BE442574_6_D_4264262SBEREVERSE4552761.5229.637394.82A/T426AGAAAAATGTTCTGAGACAACACAAAA
565BE442574_6_D_4274271SBEFORWARD401266438.465277.78A/T427AAGGTACGAGCAAATTGTGTTTACGA
566BE442574_6_D_4274272SBEREVERSE4562761.9833.337291.78A/T427GAGAAAAATGTTCTGAGACAACACAAA
567BE442582_4_B_1301301SBEFORWARD1052562.84483273.37T/C130GCCTGTGACCTTATGACTGGTAGAA
568BE442582_4_B_2122121SBEFORWARD1852763.3840.744285.69T/C212ACCTCTCAAGAAATGAAGGAAACACTC
569BE442582_4_B_3183181SBEFORWARD2922664.9138.464274.44G/T318GATCAGTTCTGCCTGCTTGAATTTTT
570BE442582_4_B_3703701SBEREVERSE3972562.12444377.82T/C370CAACTGAGGAAGGCAAGATCATAGT
571BE442608_2_A_1281281SBEREVERSE1572761.8729.636189.8A/T128AAATTAATCAAAACATTGAGCCAGAAC
572BE442608_2_D_2622621SBEREVERSE2912762.3133.335289.53T/C262AAAGAATATCAGATGCCACCAAAACTA
573BE442619_7_B_3283281SBEFORWARD3012761.4725.934393.08T/C328AAACCTTTTTATTTTTGAACACATGCT
574BE442619_7_B_3693691SBEREVERSE3982761.7244.448293.18T/C369AGAGCTCTATACCAGGTTGTCTTTCAG
575BE442655_2_D_1161161SBEFORWARD892758.8933.335394.81T/C116CACCAATGCTTAATAAACTGACTAAAG
576BE442655_2_D_1161162SBEREVERSE1462853.81255372.89T/C116TGTTACAGTTTACAGTTAGAGATTATTT
577BE442658_3_A_1851851SBEFORWARD1582760.8833.335395.49G/T185CCAAACTATGAAATACTGCTATTGGAA
578BE442658_3_A_1851852SBEREVERSE2142760.4233.335396.86G/T185TGGTGATACTGTCATATTTTACGTTTG
579BE442658_3_A_3493491SBEREVERSE3762563.7404373.08T/C349AAACTGCCATTCAAGAAAGAGGAGA
580BE442658_3_B_1371371SBEFORWARD1102763.5537.046286.43T/C137CTATTCATAAATCAGGTGCCTTTCCAT
581BE442658_3_B_3373371SBEFORWARD3102761.633.336393.96T/C337TGACCTGACTGATTTAAAGAGTTTTCA
582BE442666_4_B_2652651SBEREVERSE2932659.9538.464390.69T/C265CCTAGAACCTATAATTTTGAAGCAGG
583BE442676_5_A_2202201SBEREVERSE2472561.04448281.87A/C220GGAGGAGATCTGATCCTTACAACAT
584BE442676_5_A_5105101SBEFORWARD4842664.3738.464276.07G/C510TACATTATTTTCCGTTGAAAGAGCCC
585BE442676_5_A_5105102SBEREVERSE5392754.1125.934379.82G/C510ACTATCTGAAGAATACCATCATAAATA
586BE442676_5_B_2602601SBEFORWARD2352564.63485167.58T/C260CCTTCCTGAAATTCTGTCTCTTCCC
587BE442676_5_D_51511SBEFORWARD262563486376.43A/C51CTCCTTCTCTCTTATGAGCGGATTC
588BE442676_5_D_3403401SBEFORWARD3152554.35246368.47A/C340ATTAAAAGCTTAAAGTCTCATCATT
589BE442676_5_D_3403402SBEREVERSE3692762.2337.045391.42A/C340TTCAATAACTCGCAGAAACCTTCTTAC
590BE442676_5_D_3493491SBEREVERSE3782762.5233.333287.64G/T349ACGATAAACTTCAATAACTCGCAGAAA
591BE442700_7_B_3503501SBEREVERSE3772550.13206254.13T/C350TTATTAATTTGTGTTACTTTATCAG
592BE442700_7_B_4574571SBEREVERSE4842562.67447276.36G/C457GCTTACCAGTGATGTGGTTAGCATT
593BE442716_1_B_2912911SBEREVERSE3202761.8240.748394.55G/T291CAATGTAACGTCACTTGTCCTTGTACT
594BE442750_4_B_2462461SBEFORWARD2212564.82444166.38A/C246TTGAATTTTGACAGGAGGAGTGGAG
595BE442776_4_A_19191SBEREVERSE472657.626.927383.19G/T19GCAAAAACCTATTGTACCTTTTTTAT
596BE442776_4_A_4474471SBEREVERSE4762762.2129.634390.88T/C447AATTTGAACTGTAATGGAAGGACAAAA
597BE442776_4_A_5365361SBEREVERSE5652756.6622.225286.44A/C536TATGCAAGTAAATAAAGAAATTCAAAC
598BE442776_4_B_48481SBEREVERSE762660.1334.626290.03T/C48CGATCTATATTAATTGTCCCTGCTTT
599BE442776_4_D_38381SBEFORWARD112760.5940.744294.05T/C38GTTGTCGCTGCTTTAGTATAACTCTGT
600BE442776_4_D_38382SBEREVERSE672764.2137.046284.46T/C38AATTGTCCCTGCTTTAGCACAACTTTA
601BE442788_2_A_53531SBEFORWARD272664.6446.154275.25T/C53AACGACATGGAGATTATGAGGTAGGC
602BE442788_2_A_53532SBEREVERSE822759.3729.636295.21T/C53AACACTGGTATACTGCAAATAAATGAA
603BE442788_2_D_3083081SBEFORWARD2812764.9444.444382.67T/C308TACATCTATACAGCTAAGGTTGGCGGA
604BE442788_2_D_3093091SBEFORWARD2842562.95484273.65T/C309ATCTATACAGCTAAGGTTGGCGGAC
605BE442869_4_A_6346341SBEFORWARD6072761.9937.045392.15T/C634TAGGTTTCTCTCAAGAATCACGAACTT
606BE442869_4_B_7727721SBEFORWARD7452761.0137.046192.4T/C772GCAATTGAGCATAATAGTAACCGTAGA
607BE442869_4_D_4754751SBEREVERSE5032662.0434.626385.96T/C475AATTCTTGTCAATGGAGAACATGGTA
608BE442892_5_A_4444441SBEREVERSE4732756.4533.333182.89T/C444CAGAGTCAGAGATAAACAAAATAGAAG
609BE442892_5_D_2162161SBEREVERSE2452752.625.938276.12T/C216TAGAATATTAGAATATATCACATCAGG
610BE442918_5_B_6886881SBEFORWARD6612758.1425.934290.25T/C688TTTATTTGTTTCCATTAACCATTACTC
611BE442918_5_D_1941941SBEREVERSE2232761.3125.935288.82T/C194TAGAAATCAGTTTTTTTTTTCAAAGCC
612BE442918_5_D_2182181SBEFORWARD1912764.3929.635279.58T/C218AGCTTGGCTTTGAAAAAAAAAACTGAT
613BE442918_5_D_2352351SBEREVERSE2642761.2840.746394.91A/T235CCATAGGTACGTGTGTATTTTTCTCAG
614BE442918_5_D_2542541SBEFORWARD2272756.622.225181.99T/C254TTAAAAAAATCTGAGAAAAATACACAC
615BE442918_5_D_2542542SBEREVERSE2832755.2533.336384.51T/C254ACAGAAAAGTAGTATACATCCATAGGT
616BE442918_5_D_4864861SBEFORWARD4563057.53204367.75A/T486CTGTGTATTTATTTTCAGTTTTTTTAACTT
617BE442918_5_D_4914911SBEREVERSE5192660.4630.778391.95A/T491GGACTTTTCTAAAATTCAAAAGCTGA
618BE442982_7_B_79791SBEFORWARD522755.0425.934280.96T/C79AATAATAGTAGCATCTTTGACACATAA
619BE442982_7_B_79792SBEREVERSE1082758.0325.934188.26T/C79TTCAGGTATTTACTTTTCTGATTGTTT
620BE442995_4_A_60601SBEREVERSE892759.4525.933392.99G/T60TATCAAAAAATAAGGACAACAAAGTGA
621BE442995_4_A_72721SBEREVERSE1012760.5433.335292.63T/C72AGCTCCGAACTATATCAAAAAATAAGG
622BE442995_4_A_2142141SBEFORWARD1892564.04485271.01A/T214GCTGTCGCTAAGGTCAGTCGTATTT
623BE442995_4_A_2692691SBEFORWARD2422752.129.638274.65G/T269AAGTACTTCTTTCTGTATGTTATGTAG
624BE442995_4_B_1211211SBEFORWARD942758.6529.634393.44T/C121ATCATATTTCACTTTGTTCTCCTGATA
625BE442995_4_B_3883881SBEREVERSE4152564.64443267.96T/C388AACAAGGTCAAGGAACATCATCAGG
626BE443010_7_A_4614611SBEFORWARD4352662.2638.465283.01T/C461CGGATGAAACAGTTCTTCTGTTATTG
627BE443010_7_A_4614612SBEREVERSE4902763.1437.042285.16T/C461CTAATGAAAGTATGCGACAAAAGGATG
628BE443010_7_A_4774771SBEREVERSE5062764.3137.044384.56T/C477TTTGGCAGGAAAGACACTAATGAAAGT
629BE443010_7_B_2402401SBEFORWARD2132761.8740.743187.93T/C240CAAACTATTGACCTCTGATTCTTCTCC
630BE443010_7_B_3543541SBEFORWARD3292563.65444271.55T/C354CAGACCGAACCTGTATGTTTTCTCA
631BE443010_7_B_3543542SBEREVERSE3832753.9525.935379.97T/C354AAGAAAGATATGAAGAATACATAGTTG
632BE443010_7_D_2812811SBEFORWARD2542755.2129.636282.71T/C281ATGAAGTCTAGGTTTAATCTTCTTATG
633BE443016_5_A_6016011SBEFORWARD5742757.633.335289.27T/C601TTGATATGCTGTATAAGTAGCAAAGAG
634BE443044_7_D_85851SBEFORWARD602561.19405279.55T/C85AGACCAAGTTCCTTGATTGTTCTTC
635BE443044_7_D_4284281SBEFORWARD4012764.5240.748284.79T/C428TACATGTGCAAATGATAGAGATGGAGC
636BE443044_7_D_6756751SBEFORWARD6482753.429.637277.91G/C675CAGGTATAACTTATGTCTAGTTCTTTT
637BE443044_7_D_6756752SBEREVERSE7032659.238.467288.64G/C675GTCAAGAAGTTAGTGACATAAAGGGA
638BE443053_3_D_40401SBEFORWARD152564.17404371.66T/C40TACTTGCATTATTGTTCGGTTGTGC
639BE443068_1_A_3203201SBEREVERSE3492763.2837.044387.66T/C320TGTGAATAGAGCTTTCCTTTTCTTTCC
640BE443068_1_B_3103101SBEFORWARD2832762.9544.442285.74T/C310GTGTGGAAGAGAGAAACTATGAAGCAG
641BE443068_1_D_41411SBEFORWARD152664.8838.463273.89T/C41AAGAAAAATCATCACATCCCTCGGTA
642BE443094_2_A_1741741SBEREVERSE2022664.9842.314274.22T/C174TTGGGTTTTGTTCGTACTGACTGCTA
643BE443094_2_B_4714711SBEREVERSE4992657.7234.626385.24A/C471GATTTTTCTTGTACAGCGTATATCAG
644BE443094_2_D_51511SBEFORWARD262564.85444267.95T/C51TAAGCACAAAGCCTGCTAAAGAACG
645BE443094_2_D_51512SBEREVERSE792664.6646.155377.49T/C51CTTCTTGGTGTCTTCAAGCAACTGAC
646BE443187_5_A_2692691SBEREVERSE2982761.3833.335292.31A/C269TCGTTGAACTAAACTGAAATACACGAT
647BE443187_5_A_5635631SBEFORWARD5382564.17445270.6T/C563GCGATACCGGGTTAGTGATTGTTTA
648BE443187_5_B_4204201SBEFORWARD3932763.437.048288.14A/C420AATCTGATCAGTAGGGCAAGCATTTAT
649BE443187_5_B_4204202SBEREVERSE4472554.13208369.04A/C420CGAATCAATTAATTATAGAAACAAA
650BE443187_5_D_2382381SBEFORWARD2122663.9542.314378.99T/C238ATGGACAACCTGATAAACCGTACCTT
651BE443190_4_B_94941SBEFORWARD672761.5837.044291.1T/C94TCCAGACACACTTCAAAGAACTTACAT
652BE443190_4_D_1071071SBEREVERSE1352664.2538.466379.34G/C107ATGGATCTGTGTTTGCAACAGTTCTT
653BE443232_4_A_65651SBEFORWARD382758.1929.635288.43A/T65GAAGTGACTATTTTTTTCTGATTGAAG
654BE443232_4_A_2222221SBEREVERSE2502664.1238.464276.82A/C222AAGCAATCAGAACAAAGCAGATCAAG
655BE443232_4_B_80801SBEFORWARD532754.5829.637383.11G/C80TCTATGCTAGTGTCTAGGATTATTTTA
656BE443288_3_A_1411411SBEFORWARD1162563.59404373.4T/C141AATCCCTATGTTTCATCTTTGCAGG
657BE443288_3_D_2812811SBEFORWARD2542763.9640.744283.95A/T281ATGGTAATATCTGAACCACGACCACTT
658BE443291_4_A_22221SBEREVERSE492564.99363266.91T/C22AATCTGAAAATCCCGCAAACTGAAT
659BE443291_4_D_1681681SBEREVERSE1952564.29443268.99T/C168CAACCAGTGATAATACGCCATTCCT
660BE443312_7_B_2122121SBEFORWARD1872564.81445268.7T/C212GGAAACAGCCTCTTGCAGAAATGTA
661BE443312_7_B_2122122SBEREVERSE2402664.5742.316175.03T/C212TTTGGGTCTTTTGTACGTAGCCTTTC
662BE443312_7_D_2642641SBEREVERSE2932764.4437.048285.01T/C264TAGCCATATGCACATAGCCAACATAAA
663BE443396_7_B_3563561SBEFORWARD3302662.642.314383.04T/C356CTGCGACAGAGCTGAACTTTAATATG
664BE443439_5_D_2022021SBEREVERSE2312762.4929.638392.52A/T202CAAGATAATTGATTTCTTATGGGCAAA
665BE443521_7_B_80801SBEFORWARD532762.437.046083.6T/C80CTACACTCCCCAAATTTTTTTTACCTC
666BE443521_7_B_85851SBEFORWARD582764.6137.046280.3T/C85CTCCCCAAATTTTTTTTACCTCGTATG
667BE443531_1_B_1051051SBEREVERSE1342763.1637.048390.53G/T105ACACCTTGTTTACAAGCATAGACCAAA
668BE443531_1_B_5355351SBEFORWARD5082756.7133.333183.67T/C535ATACTAACCAATCTTCTTCACTCTTCT
669BE443531_1_B_5355352SBEREVERSE5622563.32406375.46T/C535GGAAAACTAAAGAATTGCAGTTGGC
670BE443531_1_B_5665661SBEREVERSE5932564.48443268.42T/C566GCCACAACAGGGCAAGAACTAAATA
671BE443531_1_D_1081081SBEFORWARD812761.6340.744290.95T/C108CTGCATCAGTGTTATCTACCTGAAAAG
672BE443531_1_D_1591591SBEREVERSE1862560.44445383.47T/C159GTTTTGGTGATGTAGTCTAAGCAGG
673BE443540_7_D_8138131SBEREVERSE8422761.9929.634391.52A/C813CTTTTAAGCCAATGAAAACAAAACTGT
674BE443540_7_D_8968961SBEREVERSE9252763.8337.044284.35T/C896GTGTATCACAGCCAATGAAAACAAAAC
675BE443554_7_D_2742741SBEFORWARD2482660.4334.622286.62T/C274GAGGTTTGTTCTTCTGTTGTTTTTCT
676BE443554_7_D_2742742SBEREVERSE3032759.5633.336194.11T/C274TAATATTCCTTAGAAGAAACAACTGCC
677BE443568_3_A_1411411SBEREVERSE1702755.625.934282.64A/T141TTGAAAATACCATATACTACACGATTA
678BE443568_3_A_1541541SBEREVERSE1812564.93405268.33T/C154CTGGCATTCCGTTGAAAATACCATA
679BE443568_3_D_1731731SBEFORWARD1472660.0934.626391.82T/C173CTTGACTGAAATTTAGGAAGTTGACA
680BE443588_1_A_3393391SBEFORWARD3122764.6440.744281.92T/C339CTTTGTTATCGGACTATATTGCATCGG
681BE443588_1_A_3393392SBEREVERSE3662562.76444274.22T/C339AGCGACTATCCAGATGATACAATGC
682BE443744_6_A_67671SBEFORWARD402758.7925.936395.13A/C67AATTAATATCTTCCCTTTTGTCATCAT
683BE443744_6_A_67672SBEREVERSE972856.42254380.09A/C67TGATAGTGAAAAGAAAAGTTAGAACATA
684BE443745_5_A_1291291SBEREVERSE1582764.8429.637382.62A/C129AGTTCATTGACAATTGGAAGCAAAAAA
685BE443745_5_A_1301301SBEREVERSE1582663.9830.777279.1T/C130AGTTCATTGACAATTGGAAGCAAAAA
686BE443745_5_D_82821SBEREVERSE1102663.9830.777279.1G/T82AGTTCATTGACAATTGGAAGCAAAAA
687BE443751_5_D_4064061SBEFORWARD3792759.5625.934396.18T/C406TAATTGTTTACACCGGAGATTTTTAAT
688BE443751_5_D_4064062SBEREVERSE4352760.3929.636295.9T/C406TGACAACTTATATGCATCTGAAAGAAA
689BE443771_2_B_1881881SBEFORWARD1632561.11406382.1A/C188CAGATCTAAGAATAGCCCGATTTGT
690BE443797_1_A_66661SBEFORWARD392764.9940.745179.83T/C66AACAAGTGACTACATACGGGAGCAAAA
691BE443930_1_A_76761SBEFORWARD512562.13443275.48A/T76CTTGTGATAGCCCTGTTCTTTCTGT
692BE443930_1_A_1831831SBEFORWARD1562763.1937.046389.17T/C183AGGAGTTCTCCAAATGCAAAGAATTAG
693BE443930_1_A_4154151SBEFORWARD3892664.0446.156379.97T/C415GAGGTAAATTTGTTACGACTGGGACC
694BE443930_1_A_5935931SBEREVERSE6222764.9748.155179.87T/C593TAGCAATCTTTACTAGCTCCCCCACTC
695BE443936_7_D_1931931SBEREVERSE2212664.2546.155378.72T/C193AGTAGAAGCAGATCATCAAGGCACTG
696BE443973_4_A_1301301SBEFORWARD1032759.1725.936396.26T/C130TCTTCGTGTTTCTTTGTTTTATAATTG
697BE443995_3_B_1221221SBEREVERSE1502664.9942.314375.87A/T122TCCCTCCGCTCACAAATATAAGATGT
698BE443995_3_B_1991991SBEFORWARD1742563.34404272.49T/C199CATTCCATGTTTCATACCGCTCTTA
699BE443995_3_B_4694691SBEFORWARD4422762.5440.746289.45G/C469GATCTTCTCCTTCATGCAGTTCTCTAA
700BE444125_7_D_98981SBEFORWARD712761.8129.634290.4A/C98TTAACTGGATATGTTTTCATCATTGGA
701BE444125_7_D_98982SBEREVERSE1252562.98446376.47A/C98AAACAACAGTCACAGCTTTGCTACC
702BE444125_7_D_1791791SBEFORWARD1532660.6542.314287.21T/C179GTACAAAAGACTACTGGGAAAACCTG
703BE444125_7_D_3113111SBEREVERSE3402755.8729.633282.82T/C311ACAAGACAAAGTAATAGGAAAACATAG
704BE444125_7_D_3203201SBEFORWARD2932758.3533.336393.81T/C320ACCTAGGAAAATCTCGTATTCTATGTT
705BE444125_7_D_3203202SBEREVERSE3492757.8537.046188.96T/C320AAGTACTCGACAAGACAAAGTAATAGG
706BE444144_2_A_88881SBEFORWARD622663.0142.316383.05G/T88AAGGTCTGGCTTCAAGGTAACTTCTT
707BE444144_2_A_88882SBEREVERSE1172763.4440.744183.84G/T88ACATCACACAGCTATAACATCCAATCC
708BE444144_2_A_95951SBEFORWARD702564.9446269.04T/C95GCTTCAAGGTAACTTCTTGCGGATT
709BE444144_2_A_95952SBEREVERSE1242761.0233.334394.43T/C95TGTTTTCACATCACACAGCTATAACAT
710BE444144_2_A_1391391SBEFORWARD1142558.94284279.31T/C139TGTGAAAACACAATAACTTCCAAAT
711BE444144_2_A_1751751SBEFORWARD1482761.9129.634391.78A/T175ATGTTTCAGTTCCACATGATTGTTAAA
712BE444144_2_A_2152151SBEFORWARD1882758.7129.636394.87T/C215AGACTATTGCTATGAATAATGTCCAAA
713BE444144_2_A_2192191SBEFORWARD1922759.7529.636296.33T/C219TATTGCTATGAATAATGTCCAAAAGTG
714BE444144_2_A_2192192SBEREVERSE2482764.2540.748387.25T/C219ATATGTCGGAAATCTCCGGTTTCTAGT
715BE444144_2_A_2732731SBEFORWARD2462757.2125.938391.64T/C273ATAATTATCAAGGAAAGCATATTGTCT
716BE444144_2_A_2732732SBEREVERSE3022760.1122.225296.13T/C273TAAATTACCCCAACAAAATCATAAAAA
717BE444144_2_A_2742741SBEREVERSE3032759.3422.225294.47T/C274ATAAATTACCCCAACAAAATCATAAAA
718BE444144_2_A_2932931SBEFORWARD2662760.6825.933191.5T/C293ATTGTCTTGTTTTTATGATTTTGTTGG
719BE444144_2_B_2552551SBEREVERSE2842760.5829.634395.75G/C255TCATAAAAACAAGACAATATGCTTCCT
720BE444256_6_D_4344341SBEREVERSE4632764.3240.744282.87T/C434TTTGCGTACTTCTCCACTAACAAAGGT
721BE444264_2_B_5875871SBEREVERSE6162759.4740.746295.5G/T587TTATCATGAGCGTAGATGAGTAGTAGC
722BE444264_2_D_76761SBEFORWARD492760.7337.046294.89T/C76GATGAATAATAACCTTAAGTTCCCTGC
723BE444264_2_D_4954951SBEFORWARD4682758.9629.636395.62T/C495AAACATCAAGCATGTTCTAAGTTCTAA
724BE444266_1_A_31311SBEREVERSE592663.6646.155380.48T/C31ACTGATGGCATGTAAGTCTCGCTAGT
725BE444266_1_A_74741SBEFORWARD472764.7240.747283.55G/C74CATGCCATCAGTGATAAAGAAGAGGTT
726BE444266_1_A_1541541SBEREVERSE1832751.4422.228374.32G/C154TATAATTGTACTATTTATTCACAGATG
727BE444301_7_A_2372371SBEREVERSE2662759.2733.333293.03G/T237ACATAAATAGTAAGAACACAACCACCA
728BE444305_1_A_2762761SBEREVERSE3052763.8140.744284.41T/C276TTTGTACCTGATCTCAAACCTGAAGTG
729BE444305_1_B_1291291SBEREVERSE1572663.1338.465178.72T/C129ACAAGTGAAGAAAAACTTGATGAGCC
730BE444305_1_B_1791791SBEREVERSE2082762.5437.044288.21A/C179ATCTTTGTACCTGATCTCAAACCTGAA
731BE444305_1_B_4434431SBEREVERSE4702564.84485370.26T/C443GACCCCAAGGAAATTCACTAGCACT
732BE444305_1_D_99991SBEFORWARD722763.1240.744388.15T/C99TCTTTGTACCTGATCTCAAACCTGAAG
733BE444305_1_D_1481481SBEFORWARD1222663.1338.465178.72T/C148ACAAGTGAAGAAAAACTTGATGAGCC
734BE444353_5_D_7407401SBEREVERSE7682661.1230.774184.13G/C740AAACATCTTCAGTTCACAAACATTCA
735BE444359_1_A_2862861SBEFORWARD2592759.6829.635193.82A/T286AAATTCTCAAGCTGCATAGATAAAAAC
736BE444359_1_A_2862862SBEREVERSE3132561.25444380.41A/T286CACAAACCTGTGACGTGATACTACA
737BE444359_1_B_2792791SBEREVERSE3062564.2484371.56G/T279GACCTTTGCATTCAGGGCAGTATAG
738BE444458_4_D_4494491SBEFORWARD4222762.4140.745390.9T/C449GTAGCATCCTGGCTTCTGATATAAATG
739BE444458_4_D_7697691SBEFORWARD7432662.0742.316385.87A/C769CTTCCTCCTTGTGCACTTGTCTAATA
740BE444458_4_D_7837831SBEFORWARD7562757.8129.635391.56T/C783CACTTGTCTAATAAAAGGTATTTGCTT
741BE444505_1_B_1861861SBEFORWARD1592761.1737.046293.57T/C186GTATAAGCAAGTACTCGATCCCATTTT
742BE444505_1_B_3633631SBEFORWARD3362759.6537.047398.33T/C363AGATAAGTAACCTGATCTCAATTGCTC
743BE444505_1_D_1421421SBEREVERSE1712762.8825.934386.65A/T142ATTGTGTTTGGTTTGCATTAGAAAAAA
744BE444505_1_D_2152151SBEREVERSE2442764.9544.445281.61A/T215TTTCTAGCCTGTGACACTCTGCTTTCT
745BE444505_1_D_3603601SBEREVERSE3892760.3125.934294.91A/T360GGTTTTTAATCCATTCTTTGATTCTTT
746BE444541_2_A_1111111SBEFORWARD842762.0240.744289.77T/C111ACCAACTCTAGCACAGAAGAAGGTAAA
747BE444541_2_A_1181181SBEFORWARD912756.2433.335386.85T/C118CTAGCACAGAAGAAGGTAAACTTAATA
748BE444541_2_A_1431431SBEREVERSE1712663.0534.625382.31T/C143GATTGTTTCTTTGACAAGCGTTTCTT
749BE444541_2_A_1491491SBEREVERSE1762564.46366372.03T/C149TTCATGATTGTTTCTTTGACAAGCG
750BE444541_2_A_1531531SBEREVERSE1822761.529.638395.5T/C153AAGAACTTCATGATTGTTTCTTTGACA
751BE444541_2_A_1681681SBEFORWARD1432563.36365374.7T/C168ACAAGAAACGCTTGTCAAAGAAACA
752BE444541_2_A_1801801SBEREVERSE2092763.9337.045386.34A/T180GATCATTTAATTCCTTGCCTGCATATC
753BE444541_2_A_2172171SBEFORWARD1922560.23365282.43T/C217CAAGGAATTAAATGATCCAAGAGTG
754BE444541_2_A_2402401SBEREVERSE2672564.24484371.46T/C240ACACCACAGTCACGGATCTCTTGTA
755BE444541_2_A_2522521SBEFORWARD2272564.84446370.88T/C252TTGGTGATGTCCCCATACAAGAGAT
756BE444541_2_A_2522522SBEREVERSE2812764.8344.447384.89T/C252ATCTGTCATCTTCAACACCACAGTCAC
757BE444541_2_A_3393391SBEREVERSE3682763.337.047389.48T/C339TGGATATTCTGAATCAAACATAGTGGG
758BE444541_2_A_3743741SBEFORWARD3482660.1330.777392.31T/C374TGTTTGATTCAGAATATCCAAGACAT
759BE444541_2_A_4034031SBEFORWARD3733050.69206249.15G/T403TTCTAGTACTGTATTTAGTATCTTATTTTA
760BE444541_2_A_4064061SBEREVERSE4342659.3130.778289.6T/C406GAAAATAATTATCACAAACTTCACCG
761BE444541_2_A_4104101SBEFORWARD3832754.929.634280.53G/C410GTATTTAGTATCTTATTTTAGAACCCG
762BE444541_2_B_40401SBEFORWARD132757.7829.634390.83A/C40TTTATCAAAGAAAGAGTTATGGAGTTC
763BE444541_2_B_40402SBEREVERSE682664.4938.465378A/C40ATCATTTAATTCCTTGCCTGCATAGC
764BE444562_5_B_98981SBEREVERSE1272762.9340.746389.97T/C98AAAGGCCTAACCTTATATCAAGCTCCT
765BE444562_5_B_1441441SBEREVERSE1732761.8540.747393.83T/C144ATGATAGGATCATAGGACCAGTCAATC
766BE444562_5_B_2322321SBEFORWARD2052755.9729.636183.32A/C232TTTTTCTAGTTAACCTCAACATTAGTC
767BE444562_5_B_2342341SBEFORWARD2072756.633.336388.55A/T234TTTCTAGTTAACCTCAACATTAGTCAC
768BE444562_5_B_2342342SBEREVERSE2632760.5537.047397.72A/T234TTGAGACTTTCAAGGTCAAAAGTAGAC
769BE444562_5_B_2502501SBEREVERSE2792762.6540.743388.92T/C250GAATAGATGCCAGTGATTGAGACTTTC
770BE444562_5_B_2532531SBEREVERSE2822763.6840.744386.46T/C253AAGGAATAGATGCCAGTGATTGAGACT
771BE444562_5_B_2702701SBEFORWARD2442664.8342.317276.56T/C270TTGACCTTGAAAGTCTCAATCACTGG
772BE444562_5_B_7257251SBEFORWARD6982760.9537.044394.66G/C725CTTTGGTAGATGCGATGTATGTAACTT
773BE444562_5_B_7637631SBEFORWARD7372654.0330.775373.54T/C763CATAGTATTTGACTCTTTAGACATGA
774BE444562_5_B_7637632SBEREVERSE7922761.4837.048395.56T/C763CACTAGGAAATTGACATGTAAAAGCAG
775BE444562_5_D_3663661SBEREVERSE3932564.32522166.63G/C366GGACGGAGGGAGTATTTAGGAACAG
776BE444562_5_D_5925921SBEREVERSE6212761.0237.044292.76A/T592TCCCTTCATTCCTAAATATAAGTCCAC
777BE444579_3_B_3753751SBEREVERSE4042764.4840.745283.02A/T375CAGACAGATTTACCGAATAGGGAATGA
778BE444579_3_B_6246241SBEFORWARD5982660.338.466391.19T/C624GATATCCATCTGTTAACTTTGCACTG
779BE444579_3_B_6246242SBEREVERSE6532761.5840.744189.43T/C624CTCCCTATATCTTCTGCAACAATTACC
780BE444579_3_D_1371371SBEREVERSE1642564.01365372.76T/C137ATTCACCCCCTTTGAAACAAGAAAT
781BE444579_3_D_4204201SBEREVERSE4492760.3822.226395.38T/C420AATTCACATTTGTGTTTTTTCTTCATT
782BE444631_6_A_2422421SBEFORWARD215276133.334392.27A/T242TCTTGTAGCAAAAAACAGTGAAACTCT
783BE444644_5_A_4274271SBEREVERSE4562764.7840.742280.25A/C427AAGGGGAGAAAAGAGGATGAAAATACC
784BE444691_7_D_1001001SBEREVERSE1292764.0544.444385.35T/C100CATCTCCACTTTCGATATAGCAGTCCT
785BE444702_5_A_1841841SBEREVERSE2132757.940.746290.78G/C184TGAGACACCTTCTACTAGTCAGTTACA
786BE444720_5_A_1951951SBEFORWARD1682763.8944.447387.72T/C195AAACTGTGTTTCCTAAACCCTAGTCCC
787BE444720_5_B_3073071SBEREVERSE3352662.9938.465179.15T/C307AACAAGTGACTACATACGGTGCAAAA
788BE444720_5_B_3713711SBEFORWARD3442760.4737.048195.26T/C371ATAAAGACAAGTATTTAGGAACGGAGG
789BE444720_5_B_3713712SBEREVERSE4002756.7840.744387.84T/C371TTCAGGAACACTACAGCTAGATACTAC
790BE444811_4_A_2472471SBEFORWARD2202761.140.745394.83T/C247CGTTACTTTCTAGGTTAGCTCCAAATC
791BE444846_1_B_1591591SBEFORWARD1342564.24485270.4G/T159CTCTGAACACCAGAGAAACCGACTT
792BE444846_1_B_2482481SBEREVERSE2772762.4229.636391.49T/C248TCAATTAACATCAACTAAATTTTGCCC
793BE444846_1_B_4924921SBEREVERSE5192560.28368284.15G/T492CATGTTGGACATGTAGAAATGAAGA
794BE444846_1_D_2362361SBEREVERSE2652760.9637.044290.75T/C236CTCTACAGATGAAAAAATGAAGCAGAC
795BE444846_1_D_5545541SBEREVERSE5812555.07247269.59A/T554TGTTGAACATATAGAAATGAAGAAA
796BE444846_1_D_5755751SBEFORWARD5482756.8725.937389.99T/C575TCAAACTGTTTCTTCATTTCTATATGT
797BE444858_4_A_87871SBEFORWARD602763.1933.334286.27T/C87TTTTCATCCCTATGCTTTGGTTAGATT
798BE444858_4_B_2132131SBEFORWARD1882554.36327267.46G/C213CCTTGATAATATGTAGGAGAAGAAT
799BE444858_4_D_2542541SBEREVERSE2812563.5484272.01T/C254GAAGTCATCCAAACTAAGAGGACGG
800BE444864_3_B_1951951SBEFORWARD1682764.1744.444384.98T/C195AGTTTATTGATCTGGTGCTCTCAGGAC
801BE444864_3_B_2982981SBEFORWARD2712757.829.634390.9T/C298AACTTGATTAGTACCGACATGATTTAT
802BE444864_3_B_3073071SBEREVERSE3362764.1237.043384.51A/T307TTCAACCAAAGATGTCCCTTCATAGTT
803BE444864_3_B_3643641SBEFORWARD3372759.9837.044194.09A/T364TCTCATTGTACCCTATCTTCTGTTTCT
804BE444864_3_B_4514511SBEFORWARD4262564.94366268.92A/T451AATGGATCATTGGTAATTTTTCGGC
805BE444864_3_B_4904901SBEFORWARD4632760.3833.336194.27T/C490TAAATCTTTAATCTCACTGCAAGAACC
806BE444864_3_B_5455451SBEREVERSE5742762.133.334187.85A/C545ACATGAAACCTATGGTAATCCTGAAAA
807BE444864_3_B_5465461SBEREVERSE5752761.0833.334292.58A/C546TACATGAAACCTATGGTAATCCTGAAA
808BE444864_3_B_5475471SBEREVERSE5742560.02364180.77G/T547ACATGAAACCTATGGTAATCCTGAA
809BE444864_3_D_1151151SBEREVERSE1442762.6533.335390.16T/C115CTTTGTGAATCCGATCAATCAACTTAT
810BE445011_3_D_70701SBEREVERSE982660.9334.626287.62T/C70GAAGGGGAAATTTTTCTTACTTCTTG
811BE445121_1_A_42421SBEREVERSE722860.0439.293390.09G/C42GCTCTTTATCCTTAGTGGTAGAAACTGT
812BE445121_1_A_3853851SBEREVERSE4142757.4922.226391.22A/C385TTTGACCAACAATTAGTTTTAATGATA
813BE445121_1_A_4184181SBEFORWARD3912760.1129.636296.77G/C418ATTAAAACTAATTGTTGGTCAAAGCAC
814BE445121_1_A_4484481SBEREVERSE4752556.6368173.14T/C448CTAATTAGTACTCCCTCCTTTTTCA
815BE445121_1_A_4724721SBEFORWARD4452758.3829.636393.89T/C472TAATTTGAAAAAGGAGGGAGTACTAAT
816BE445121_1_A_5525521SBEFORWARD5242859.0732.148187.22T/C552TGTAGATATACATAACAAATGCAGGAAG
817BE445121_1_A_6606601SBEFORWARD6352564.49444370.69T/C660TCTTCAACCTAACCTGCAAGGAGAA
818BE445121_1_A_6606602SBEREVERSE6892761.5229.637394.82T/C660TCACTTCAACAATCAGTTGTTCTTTTT
819BE445121_1_A_6856851SBEREVERSE7142762.1133.336290.77G/T685TGGTGACATATTAATTGGTGTTGTTTC
820BE445121_1_D_2302301SBEFORWARD2032760.837.044395.11A/T230TATACGAGATTACGGTCAAAATACGTC
821BE445121_1_D_5115111SBEFORWARD4842758.0333.336392.85T/C511TAGAATTTTACTAGCAGATTTGAGAGG
822BE445181_5_B_5115111SBEFORWARD4842760.6137.044294T/C511AGTAGTTCTATGGATAAGATGGCAACA
823BE445181_5_D_20201SBEREVERSE492758.0929.636291.34G/T20TAATATTTCATACTAAAAGAGTGGCGT
824BE445181_5_D_1561561SBEFORWARD1292760.6837.044395.45T/C156ACAGTAATTCTCTGGAGGAAAAATAGC
825BE445181_5_D_3113111SBEREVERSE3402757.4929.634389.98A/T311CCACATACTTCCTATTTTTCTATGAAT
826BE445184_4_B_93931SBEFORWARD662763.8440.744284.32G/C93GTCCATAGGATTTTAGGTGCAGAAGAA
827BE445184_4_B_93932SBEREVERSE1222757.2929.636390.62G/C93GTTCTGGTTACTCTTTTTAATTATTGG
828BE445184_4_B_2552551SBEFORWARD2292664.5634.624275.49T/C255TTCAGATTTCAATTTCACTTGCTTGG
829BE445201_6_D_1701701SBEFORWARD1452558.58364278.25A/C170ATGGTAGCACACTTAAACAATCATC
830BE445201_6_D_2722721SBEREVERSE3012763.1237.045287.1T/C272AACGGTGGTGGAAGTTATTTCAGTTAT
831BE445201_6_D_4894891SBEREVERSE5182757.0125.934284.65A/T489AGAAGTTTGTCCAGTTTAATTTTTTAC
832BE445201_6_D_5165161SBEFORWARD4892755.6522.224382.22A/C516TAGTAAAAAATTAAACTGGACAAACTT
833BE445201_6_D_5165162SBEREVERSE5452760.6725.936295.06A/C516TTTTTAGAAACCATTCAAGAAAACAGA
834BE445201_6_D_5575571SBEFORWARD5302761.9133.337190.31T/C557TTGCATACAAGCCTTTATTCCTATTTC
835BE445201_6_D_6076071SBEFORWARD5822564442167.57T/C607GGTGCTGTTGCTTGTTTGTTGTATC
836BE445201_6_D_6246241SBEREVERSE6512564.81484268.06T/C624AAAACAAGGCTAGGCAGATACGGTC
837BE445201_6_D_6336331SBEREVERSE6622763.2137.048390.36G/T633GTTTCTTTTAGAAAACAAGGCTAGGCA
838BE445220_7_D_1041041SBEFORWARD772761.5133.334392.98T/C104AAAGCACCATCATCAGGTAAATAAACT
839BE445220_7_D_1041042SBEREVERSE1312563.91444270.77T/C104GGAATGTGGCTTTAATTTCCTACCC
840BE445220_7_D_1161161SBEFORWARD892761.5737.044189.44A/T116TCAGGTAAATAAACTCTGGGTAGGAAA
841BE445220_7_D_1601601SBEREVERSE1902858.7532.144387.09T/C160GCATTGTTTTTAACTCTTATCTTCTAGC
842BE445220_7_D_3443441SBEREVERSE3732762.8637.044388.92T/C344GTAAAGCAATACCCCTTTCTTGTTTGT
843BE445242_2_A_4154151SBEREVERSE4442757.2237.045288.13T/C415AACATAAGTCTAACCTAGAAAGTGAGC
844BE445242_2_A_4284281SBEFORWARD4022652.6530.778269.61A/T428TAATGTTTAGTACTAGCTCACTTTCT
845BE445242_2_A_4284282SBEREVERSE4552556.26328375.46A/T428TTCTTTGCAAGAACATAAGTCTAAC
846BE445242_2_D_2202201SBEREVERSE2472550.46287357.42G/T220CTGAACATTATTAACTGTACTCATA
847BE445278_2_B_2452451SBEFORWARD2202563.84528375.13G/C245GTCTAAGATCTTCCGGATCTCCTCC
848BE445278_2_B_2452452SBEREVERSE2722563.52445272.58G/C245GATCATCACAACACAACCATACACG
849BE445287_7_A_3293291SBEFORWARD3032662.4146.158386.1T/C329AAGTACCACCGGTAGTTGCCTAGTTA
850BE445287_7_A_4614611SBEREVERSE4902758.8133.333291.63T/C461AATCAACTATCAGGAGTGACAAACTAA
851BE445287_7_B_1991991SBEFORWARD172276037.044295.82G/C199TTGCCTAGTTATGTATGTTTCTCTCCT
852BE445287_7_B_3043041SBEFORWARD2772759.3737.046396.86G/C304TAGTGTCCTATGAAACATTGTGTAGGT
853BE445287_7_B_5365361SBEFORWARD5063058.04206268.21T/C536CTATGTAAACTTATCATTACCAAAAAAAAA
854BE445287_7_B_5365362SBEREVERSE5652762.5837.045390.38T/C536AAGTACAGTGTGAGGCAATTTCTTGAT
855BE445348_3_B_3313311SBEFORWARD3042761.7237.046393.58A/C331AATAGCTACTGAATCTTGCTTCTTTGC
856BE445348_3_B_3313312SBEREVERSE3592662.2638.464384.06A/C331AACAAGTGATAGAAGCATGGATGTGT
857BE445348_3_B_4564561SBEFORWARD4292761.7237.046393.58A/C456AATAGCTACTGAATCTTGCTTCTTTGC
858BE445348_3_B_4564562SBEREVERSE4842662.2638.464384.06A/C456AACAAGTGATAGAAGCATGGATGTGT
859BE445431_2_A_1881881SBEREVERSE2172761.6937.046393.68G/T188AACGTGATTCTGAAGAAAGACAGTACA
860BE445431_2_B_2322321SBEREVERSE2592564.12443371.19T/C232GGTGTGATTTTGGAGGAAACAACTC
861BE445431_2_D_2862861SBEREVERSE3152762.5437.043287.58T/C286ATGATGAAAGTGAGGTAGGTCTTGAAA
862BE445431_2_D_7417411SBEREVERSE7702759.4929.636295.56T/C741AAATGTAGTGCTTCCTTTGTTTATTTC
863BE445505_7_B_4384381SBEFORWARD4132564.02526271.69G/C438GGACTGAGGTACTCCATCCTGCTTA
864BE445506_7_B_1521521SBEREVERSE1812760.2529.637398.63A/C152ATATATAATATGCGACGAAAACGATGT
865BE445506_7_B_8488481SBEFORWARD8222651.9723.087266.94T/C848TTAATAGTCACATTACAAATTAACAC
866BE445508_3_B_2092091SBEFORWARD1822758.8133.334292.25T/C209GTGTATTAGCATGATTTCTCAGTTTTC
867BE445508_3_B_2092092SBEREVERSE2372661.5630.775285.1T/C209GTTTGTATCACCAGCAAAAACAAAAT
868BE445508_3_B_4984981SBEFORWARD4712760.4125.936397.52T/C498AACCAAAAACGTGTGTTTTCTTTAATA
869BE445508_3_B_4984982SBEREVERSE5272760.1237.048399.65T/C498TGAAGGAAGGAATGATATCAGGTATAG
870BE445587_7_D_96961SBEREVERSE125276333.334286.84G/C96AGAGGGGGTTAATTCATCATTACAAAA
871BE445587_7_D_3413411SBEFORWARD3162562.83443273.37T/C341GCTTTCTTTCTGTCTGGCTAAATCC
872BE445587_7_D_3413412SBEREVERSE3702761.9129.632187.17T/C341GAAATAGCAACGAAATAACCAAAGAAA
873BE445587_7_D_4604601SBEFORWARD4332760.3333.334294.85T/C460TGTTTGTTCATGCAGAGGTACTATTTA
874BE445642_6_D_5065061SBEREVERSE5352760.9922.222187.73T/C506AAAAAACATCACACCAACAAAATAAAA
875BE445667_6_D_2252251SBEREVERSE2542756.2422.226387.48A/T225TGAATGAATATTATAAAGTGATGTTGA
876BE445834_1_D_4014011SBEFORWARD374275833.334289.82G/T401ATATACTCCCTCTGTTCACTTTTGTAA
877BE445834_1_D_4634631SBEREVERSE4922758.4833.335291.9T/C463AATTAGTTACTCCCTCTGTTCACTTTT
878BE445834_1_D_4694691SBEREVERSE4982756.3137.046387.69T/C469ATCTAGAATTAGTTACTCCCTCTGTTC
879BE445834_1_D_5375371SBEFORWARD5102755.0422.224280.94T/C537ATTTGTATTTTTATAGGACTGATTTTC
880BE445834_1_D_5375372SBEREVERSE5642564.41404368.53T/C537CATGTCCAGCAGACAAAAAATGTGT
881BE446058_5_B_2542541SBEREVERSE2842856.2621.433376.84T/C254GAATAATAACAAAATGGACTAAAAAAGT
882BE446087_3_B_4904901SBEFORWARD4632759.6633.336296.07T/C490AGATTTAGAAAGTCATGAAACCAAGAG
883BE446087_3_B_4904902SBEREVERSE5192763.7837.044284.5T/C490GAAGCAAGGTCGTTTCCCTTTATTATT
884BE446087_3_B_7507501SBEFORWARD7252562.87445376.17A/T750GCTTGGTAACTTGTGGCACTAAAGA
885BE446087_3_B_7507502SBEREVERSE7782664.6142.314173.68A/T750CTCCTGAAGAAAAGAAACATGAAGCC
886BE446087_3_D_4884881SBEFORWARD4612762.144.445391.83G/T488GGAATCAGAGAGAGATAAGTTAGCGTG
887BE446087_3_D_4884882SBEREVERSE5172757.8129.635391.54G/T488ATTTATATCCTCTCTCCAATATGAACA
888BE446153_6_B_3353351SBEFORWARD3082757.0622.224388.67T/C335CATATTTTAATTTTTGTTCTGTCATGT
889BE446153_6_D_2072071SBEFORWARD1802762.8133.336390.33A/C207CAATAATCATCTTTCCCTGAATTCCTT
890BE446153_6_D_2232231SBEFORWARD1962763.8437.046183.9T/C223CTGAATTCCTTAATTGTTCTGCTTGGT
891BE446153_6_D_2602601SBEFORWARD2332760.4933.337397.91T/C260AATGGTTAGCATTATCATAGTCTGCAT
892BE446153_6_D_2612611SBEREVERSE2902763.5233.334386.95A/C261TTACACGGGACACAAATACATGAAAAT
893BE446153_6_D_6146141SBEREVERSE6412564.5446168.58A/T614TCTGACAATTATCTGTTGCAGGTGG
894BE446161_4_B_4784781SBEFORWARD4532563.82444271.03T/C478GCCTGTGTCTTTGGAAGTTACGTTT
895BE446240_1_B_1161161SBEFORWARD892764.1829.634283.28A/C116CAATGATGATGTTTTGCTCATGTTTTT
896BE446240_1_B_1161162SBEREVERSE1432563.62444271.63A/C116AACTTTGTCGATCTTCCTGACCTGT
897BE446240_1_B_1351351SBEFORWARD1102564.31444371.25T/C135GTTTTTCAACAGGTCAGGAAGATCG
898BE446240_1_B_1991991SBEREVERSE2272664.7534.625275.55T/C199TTGTTTCTGTGGCAAAATAATCTGGA
899BE446240_1_B_2332331SBEFORWARD2062764.7633.335383.85T/C233ATTATTTTGCCACAGAAACAACTTGGA
900BE446240_1_B_2332332SBEREVERSE2612664.142.316379.77T/C233GAAATAGGCCTCACATGTCTGAATTG
901BE446240_1_B_3873871SBEFORWARD3602759.2829.636396.6G/T387CAATCCTCATTTATGATATTTCTGTTG
902BE446240_1_B_3873872SBEREVERSE4162760.4740.746194G/T387AACAGAAGACATACGTAACAAGAGGAG
903BE446304_4_B_4814811SBEFORWARD4532859.4535.713388.56G/C481GGGTATCTTGTTGATTCTCTATCTTACA
904BE446310_3_B_1431431SBEREVERSE1712652.1734.627369.22G/T143CCATATCTAGTAGTAGTACAAATTCC
905BE446310_3_B_1891891SBEFORWARD1622759.9529.634295.69G/C189TAGATATGGTGCAAATGTTTATGTGAT
906BE446344_4_B_2142141SBEFORWARD1892563.77444372.85G/T214GCATAGACGAGTTCTCATGGTTGAA
907BE446380_7_A_5665661SBEFORWARD5402662.0334.624283.07A/T566CCGTTTTAAGTTCCTTTTTCACTGTT
908BE446380_7_A_5665662SBEREVERSE5952759.9129.638399.72A/T566ATGGAATGATATCTTTATTTGTCCAAG
909BE446380_7_A_5745741SBEFORWARD5472761.7333.333391.67A/C574AAGTTCCTTTTTCACTGTTATCTTGGA
910BE446380_7_A_6666661SBEFORWARD6392761.4337.044393.22T/C666ACTCCATTTGACCTAGCTGTTTTTAAG
911BE446380_7_A_6666662SBEREVERSE6932563.7445373.69T/C666GTCAAGTAACATGCAAACAGGCACT
912BE446403_3_D_3143141SBEREVERSE3422662.238.464384.24T/C314CAGACGAATCAATATAACAGCGAATC
913BE446462_3_D_34341SBEFORWARD92564.3406372.51G/T34GCAGTCCGGTAAATTTGTGAAACAT
914BE446462_3_D_1471471SBEFORWARD1212663.3346.155279.81T/C147CTCCATTGGTAGTGTTCTCTTCTGCT
915BE446462_3_D_1681681SBEREVERSE1962661.5942.315386.68A/T168AAGAGAAACACTAGCTTCAGAACGTG
916BE446509_5_B_2872871SBEREVERSE3142564.1443371.24T/C287ATGTATCTTGGTCTAATCGGCTCCA
917BE446509_5_D_3623621SBEFORWARD3372564.78406371.08A/C362TTTCCTTCAGCAAACAAGAATGGAG
918BE446509_5_D_3623622SBEREVERSE3912760.9840.744394.56A/C362CTCACTGTCTAACTTCTCGATCAAATC
919BE446672_1_B_2132131SBEFORWARD1882562.56404274.83T/C213CCTGCATTGGTTGGTTAAAAGTAGA
920BE446672_1_D_1451451SBEREVERSE1742761.0737.045191.6T/C145AGCATCAGTTATGTCCATTTTCAGTAG
921BE446672_1_D_3563561SBEFORWARD3312560.94447281.54G/T356GACAGTGTCACTCATTTGATCTCCT
922BE446672_1_D_5005001SBEFORWARD4732764.4737.046283.68T/C500CAGAAAATGTTCCTCCTGGTAAACAAA
923BE446672_1_D_5005002SBEREVERSE5292764.1837.044283.29T/C500TATAAAAAGCAGTGGACTTGGGAAAGA
924BE471201_2_A_2952951SBEFORWARD2682763.2440.746389.02T/C295ACTGTGTTCTTGGACACGGAAGTATTA
925BE471201_2_A_2952952SBEREVERSE3222560.61403280.05T/C295ACCAACTTCTGGGACATCTTCTAAT
926BE471201_2_A_5515511SBEFORWARD5242762.8740.745287.85T/C551TTTAGCAGCTTCGATATACAGAGAGGA
927BE471213_6_A_27271SBEREVERSE562762.5240.744389.95T/C27TATAACTGGTGCTTACTTGTGCTCAGA
928BE471213_6_A_85851SBEREVERSE1142763.8133.334284.41T/C85ACACATTCGACAACCAACATAGAAAAA
929BE471213_6_A_5895891SBEREVERSE6162563.76483270.6T/C589CCAGAGACAGACAGGATACCAATCA
930BE471213_6_A_6906901SBEFORWARD6642658.9434.626388.89T/C690AAAATAGACTGATCAATGGACGTATC
931BE471213_6_B_4334331SBEFORWARD4062763.3833.337389.24G/C433ATTTCCCTGAGAAACTGTGAATTTTGT
932BE471213_6_B_4334332SBEREVERSE4602563.59444170.07G/C433GGTAGATGCAAGGGGACATAAAAGA
933BE471213_6_D_6036031SBEFORWARD5762760.3937.043395.7T/C603TAGGTATGAAAGTGATTGGTATCCTGT
934BE471268_4_D_1261261SBEFORWARD1002661.4426.924183.19A/T126GACAAACCGATAATAAAAATGCAAAA
935BE471268_4_D_1261262SBEREVERSE1552760.5229.634395.94A/T126CACGCACATACTAATAAATTGAACAAA
936BE471272_7_A_50501SBEFORWARD252564.84445268.61T/C50ACTTCCATTTGCAGTAGCAAGCATC
937BE471272_7_A_50502SBEREVERSE792759.2640.746294.86T/C50GAATAGTACAATAAGGAGCTATCCTCG
938BE471272_7_A_4504501SBEFORWARD4242664.5834.624275.43A/T450TTCAATGTGCCAAACCAAATATCACT
939BE471272_7_A_4504502SBEREVERSE4772563.89444372.48A/T450GTGAGAAAAGGAAACCTAGCCATCA
940BE474579_3_A_1021021SBEREVERSE1312760.6637.044293.85T/C102ATCTAGCAGCAATTACATTACACCAGT
941BE488206_6_A_1801801SBEFORWARD153275833.334289.82T/C180ACCTGTAGGAAAACAGATATAGAACAA
942BE488206_6_A_4084081SBEREVERSE4372756.933.335388.82T/C408TACCTGTAGGAAAACAGATATAGAACA
943BE488220_2_B_1601601SBEFORWARD1332757.6825.936186.23A/T160AAACAACACATAATTAGGAGAAAAAAG
944BE488220_2_B_2542541SBEFORWARD2282661.4434.624386.51T/C254CATGTTTCGTTTACACCATAGGAAAT
945BE488220_2_B_2542542SBEREVERSE2832759.7237.046296.23T/C254GACTAAACTTCTTGCAAAGATACCACT
946BE488220_2_B_2922921SBEFORWARD2652762.5229.636391.19A/T292TTTGCAAGAAGTTTAGTCAACGAATTT
947BE488220_2_B_4934931SBEFORWARD4662758.5225.938293.89A/T493TTCAATTAGCTCAATTTGTTAGATTTC
948BE488220_2_B_4934932SBEREVERSE5202564.61448372.83A/T493GAATTTGGGTTAGAACCCTGTGCTT
949BE488220_2_D_1811811SBEREVERSE2092661.7330.776386.89A/T181CGAAACATGCTTTTATTCAGATTCAT
950BE488220_2_D_4234231SBEFORWARD3962763.0637.045287.29T/C423AATGCTATTTGTCAATGATCTCTCTGC
951BE488220_2_D_4234232SBEREVERSE4522758.0729.636392.95T/C423GAGCTAATTGAATACAAAAATAGTTGG
952BE488233_4_D_1411411SBEFORWARD1142758.9837.048396.95A/C141TATTCCCTGATTAGTGATTACTGTGAC
953BE488233_4_D_1411412SBEREVERSE1702759.4737.045396.53A/C141CAACACAAATAGTCTCAACTACCATTC
954BE488378_3_D_75751SBEFORWARD482761.9940.744289.87T/C75GATGAACTCCTTATATGTGTCGGAACT
955BE488378_3_D_75752SBEREVERSE1042764.2829.637386.54T/C75AAATTCGGCAAATTGGAGTTTTATTTC
956BE488670_7_A_73731SBEREVERSE1022764.2433.338285.6T/C73TGAAATGGGTACGCATATAAACAATGA
957BE488670_7_A_1071071SBEFORWARD802760.4633.338398.62T/C107GTTTATATGCGTACCCATTTCATGTAT
958BE488670_7_A_1171171SBEREVERSE1462756.6725.934387.51T/C117AATTAAGTATTTCGATGGTTAGCTTAT
959BE488670_7_A_1191191SBEREVERSE1482758.4425.934392.83T/C119AAAATTAAGTATTTCGATGGTTAGCTT
960BE488670_7_D_2062061SBEFORWARD1792759.6537.044294.79G/C206AGAGTATAGATTCACTCATTTTGCTCC
961BE488670_7_D_3703701SBEFORWARD3432760.5333.335396.53A/T370ATGAAAAATACAGTCCACAGTTGAGAT
962BE488670_7_D_3753751SBEFORWARD3482756.3133.335285.39T/C375AAATACAGTCCACAGTTGAGATAATAC
963BE488779_6_D_1771771SBEFORWARD1512664.5442.312172.62G/C177ATAGTTTTCCTCGTTGCTTGTCTCGT
964BE488779_6_D_1771772SBEREVERSE2062761.537.044291.32G/C177CAGAAAGAAATCTCCAGTTATGTGTTG
965BE488921_3_A_1791791SBEFORWARD1542564.25404371.41T/C179CGGCATCTGTTTCTTATGCAATGTA
966BE489053_6_D_62621SBEREVERSE912762.2237.046392.09A/C62CAGAGAAAGCAAACCTCAAGGTATAAA
967BE489244_3_A_3433431SBEREVERSE3702560.61406281.91G/C343GTGACCTAACCAATAGAATTCACGA
968BE489244_3_D_5225221SBEREVERSE5512763.8437.043283.69T/C522AAAGAAGGCTAAACATCACAAATCCAG
969BE489244_3_D_5785781SBEFORWARD5512755.9725.938286.23G/T578TTCTATATATACCCACTTTTGTTGAAT
970BE489326_3_B_3003001SBEFORWARD2732759.7229.638399.16T/C300TATTAAATAATAACCTGTGGGGATTTG
971BE489326_3_B_5615611SBEREVERSE5902760.5829.638398.25A/T561AGAGTTTCTGCATATGAAAAATGGTTA
972BE489611_2_D_2012011SBEFORWARD1762563.83484271.01T/C201AGGCTTACCTGATACCAATCTGTGC
973BE489623_6_D_1571571SBEREVERSE1842563.66405373.8T/C157CTGTCACAATGGCTCTGAATTTGAT
974BE489623_6_D_1971971SBEREVERSE2262760.9229.632190.16A/C197AAAGAACACATCACATAAAACACAACA
975BE489623_6_D_2562561SBEFORWARD2292757.2222.225184.24T/C256ATTGCCTGTGAGTTTATTATATTTTTT
976BE489623_6_D_2662661SBEFORWARD2392755.3822.226179.32T/C266AGTTTATTATATTTTTTAAAGTGGCTG
977BE489692_1_A_49491SBEFORWARD232658.4634.625386.85T/C49ACGCTATATCAGTGCATAGAATGTAA
978BE489894_6_A_35351SBEFORWARD92664.3442.315378.44T/C35GATATGTTGAATGTTCTGGTGACCGT
979BE489894_6_A_5215211SBEREVERSE5502763.0840.744388.27T/C521CAGCCTTCACTTTGTTTGCTAGTACAT
980BE489896_6_A_2682681SBEREVERSE2972758.1233.336393.11T/C268CTTGTGACTTAATGACAGATGAAAGTA
981BE489896_6_B_4144141SBEREVERSE4432764.4244.444282.58T/C414TATGACACTGGTATGGATCAAGGACTG
982BE489901_2_B_46461SBEREVERSE752764.4540.746283.75T/C46ATAATGCAGGCAGTAAGAGCACAGAAT
983BE489901_2_B_47471SBEREVERSE752664.4242.316175.5T/C47ATAATGCAGGCAGTAAGAGCACAGAA
984BE489901_2_B_48481SBEREVERSE762664.4242.316175.5A/C48AATAATGCAGGCAGTAAGAGCACAGA
985BE489901_2_B_49491SBEREVERSE772664.4246.156277.17G/T49GAATAATGCAGGCAGTAAGAGCACAG
986BE489901_2_B_50501SBEREVERSE772563.78446272.41A/T50GAATAATGCAGGCAGTAAGAGCACA
987BE489901_2_B_51511SBEFORWARD262564.56484268.82T/C51CAACCACAGGTACAGCACAGTCATT
988BE489901_2_B_51512SBEREVERSE792664.9246.156275.64T/C51AGGAATAATGCAGGCAGTAAGAGCAC
989BE489901_2_B_52521SBEFORWARD272563.7484169.72A/T52AACCACAGGTACAGCACAGTCATTC
990BE489901_2_B_52522SBEREVERSE792564.4446372.2A/T52AGGAATAATGCAGGCAGTAAGAGCA
991BE489901_2_B_53531SBEFORWARD272664.3846.154276.02T/C53AACCACAGGTACAGCACAGTCATTCT
992BE489901_2_B_53532SBEREVERSE812664.9246.156275.64T/C53ACAGGAATAATGCAGGCAGTAAGAGC
993BE489901_2_B_54541SBEREVERSE832764.4244.446283.83T/C54GAACAGGAATAATGCAGGCAGTAAGAG
994BE489901_2_B_64641SBEREVERSE922662.3738.464383.72T/C64CTTCTTTGTGAACAGGAATAATGCAG
995BE489901_2_B_69691SBEFORWARD442563.27484272.68T/C69AGTCATTCTGTGCTCTTACTGCCTG
996BE489901_2_B_70701SBEREVERSE992761.7237.044392.34T/C70TCTACTGCTTCTTTGTGAACAGGAATA
997BE489901_2_B_77771SBEFORWARD512664.4246.156378.83G/C77CTGTGCTCTTACTGCCTGCATTATTC
998BE489901_2_B_77772SBEREVERSE1052660.7542.315287.56G/C77CACAACTCTACTGCTTCTTTGTGAAC
999BE489901_2_B_83831SBEFORWARD562764.4244.446182.16T/C83CTCTTACTGCCTGCATTATTCCTGTTC
1000BE489901_2_B_83832SBEREVERSE1112662.1842.312281.39T/C83CAACACCACAACTCTACTGCTTCTTT
1001BE489901_2_B_84841SBEFORWARD582664.5842.316276.68A/C84CTTACTGCCTGCATTATTCCTGTTCA
1002BE489901_2_B_84842SBEREVERSE1132764.7844.444281.5A/C84AGCAACACCACAACTCTACTGCTTCTT
1003BE489901_2_B_85851SBEFORWARD592664.542.316276.92T/C85TTACTGCCTGCATTATTCCTGTTCAC
1004BE489901_2_B_85852SBEREVERSE1132663.8746.154379.22T/C85AGCAACACCACAACTCTACTGCTTCT
1005BE489901_2_B_93931SBEREVERSE1222764.140.744385.21A/C93TTAATAGGCAGCAACACCACAACTCTA
1006BE489901_2_B_1151151SBEREVERSE1432664.1338.466379.68T/C115ACGGAACCGTCAGAAAAGTTGTTAAT
1007BE489901_2_B_1281281SBEFORWARD1022663.6442.314379.91A/T128GTGGTGTTGCTGCCTATTAACAACTT
1008BE489901_2_B_1331331SBEFORWARD1062763.7137.044284.7T/C133TGTTGCTGCCTATTAACAACTTTTCTG
1009BE489901_2_B_1361361SBEFORWARD1112560.54404280.88T/C136CTGCCTATTAACAACTTTTCTGACG
1010BE489901_2_B_1391391SBEFORWARD1122764.1237.044385.15A/C139TGCCTATTAACAACTTTTCTGACGGTT
1011BE489901_2_B_1401401SBEFORWARD1142660.6138.464287.34G/C140CCTATTAACAACTTTTCTGACGGTTC
1012BE489901_2_B_2282281SBEREVERSE2552563.82485271.67T/C228AGCTCTGTCATTGAGGTTAGGAGGA
1013BE489901_2_B_2312311SBEREVERSE2582563.24486274.04A/C231CTGAGCTCTGTCATTGAGGTTAGGA
1014BE489901_2_B_2342341SBEREVERSE2622664.3446.157379.69T/C234GAAGCTGAGCTCTGTCATTGAGGTTA
1015BE489901_2_B_2352351SBEREVERSE2622564.48487372.61T/C235GAAGCTGAGCTCTGTCATTGAGGTT
1016BE489901_2_B_3743741SBEREVERSE4032762.7237.046390.6T/C374GTTGCTAAAGCATCAGACATTACACAA
1017BE489901_2_B_3773771SBEFORWARD3512664.2642.318380.56G/T377ATTTGACAGGTACATGCTCATCTCGT
1018BE489901_2_B_3773772SBEREVERSE4052661.838.466386.67G/T377CAGTTGCTAAAGCATCAGACATTACA
1019BE489901_2_B_3823821SBEFORWARD3572564.67486371.4T/C382CAGGTACATGCTCATCTCGTTGTGT
1020BE489901_2_B_3853851SBEFORWARD3582763.2640.744286.04G/T385AGGTACATGCTCATCTCGTTGTGTAAT
1021BE489901_2_B_3923921SBEFORWARD3672559.6403382.34G/T392CTCATCTCGTTGTGTAATGTCTGAT
1022BE489901_2_B_3953951SBEFORWARD3692663.6942.314176.42T/C395CATCTCGTTGTGTAATGTCTGATGCT
1023BE489901_2_B_4054051SBEREVERSE4342764.0440.747387.26G/C405GTTTTAAACTTACGGATGCCAGACAAC
1024BE489901_2_B_4304301SBEREVERSE4602859.2128.575389.09T/C430CCTTTTAGGAAGAAAGAAGATAAAATGT
1025BE489901_2_B_4464461SBEREVERSE4752759.229.635393.51T/C446CAAAAAACAACTTATCCTTTTAGGAAG
1026BE489901_2_B_4534531SBEFORWARD4262757.0922.228086.28G/T453TTTAAAACATTTTATCTTCTTTCTTCC
1027BE489901_2_B_4584581SBEREVERSE4872761.333.334391.38G/C458GATCCTCGAACTCAAAAAACAACTTAT
1028BE489901_2_B_4614611SBEREVERSE4902764.333.336180.28T/C461TTTGATCCTCGAACTCAAAAAACAACT
1029BE489901_2_B_4624621SBEREVERSE4912764.5733.338384.06A/T462TTTTGATCCTCGAACTCAAAAAACAAC
1030BE489901_2_B_4714711SBEFORWARD4442758.2229.635392.78T/C471CTTTCTTCCTAAAAGGATAAGTTGTTT
1031BE489901_2_B_4714712SBEREVERSE5002761.9837.046392.82T/C471AACTAGATCTTTTGATCCTCGAACTCA
1032BE489901_2_B_4734731SBEREVERSE5022760.537.048398.51T/C473AGAACTAGATCTTTTGATCCTCGAACT
1033BE489901_2_B_4744741SBEREVERSE5022659.7338.468290.84T/C474AGAACTAGATCTTTTGATCCTCGAAC
1034BE489901_2_B_4794791SBEFORWARD4522757.1325.937388.54A/C479CTAAAAGGATAAGTTGTTTTTTGAGTT
1035BE489901_2_B_4884881SBEFORWARD4612763.3133.334385.34A/C488TAAGTTGTTTTTTGAGTTCGAGGATCA
1036BE489901_2_B_5165161SBEREVERSE5442661.7246.154284T/C516CAAGAACTTACAGGACTGAACCTGAC
1037BE489901_2_B_5195191SBEREVERSE5472663.8846.154379.2T/C519AGGCAAGAACTTACAGGACTGAACCT
1038BE489901_2_B_5315311SBEFORWARD5062564.47566371.99A/C531GTAGTGCTACCGGTCAGGTTCAGTC
1039BE489901_2_B_5485481SBEFORWARD5232561.82484175.38T/C548GTTCAGTCCTGTAAGTTCTTGCCTC
1040BE489901_2_B_5635631SBEFORWARD5372664.7342.314376.65T/C563GTTCTTGCCTCGGTCAGATGATTTAT
1041BE489901_2_D_2552551SBEREVERSE2842762.7237.046390.6T/C255GTTGCTAAAGCATCAGACATTACACAA
1042BE489901_2_D_2582581SBEFORWARD2322664.2642.318380.56G/T258ATTTGACAGGTACATGCTCATCTCGT
1043BE489901_2_D_2582582SBEREVERSE2862661.838.466386.67G/T258CAGTTGCTAAAGCATCAGACATTACA
1044BE489901_2_D_2662661SBEFORWARD2392763.2640.744286.04G/T266AGGTACATGCTCATCTCGTTGTGTAAT
1045BE489901_2_D_2762761SBEFORWARD2502663.6942.314176.42T/C276CATCTCGTTGTGTAATGTCTGATGCT
1046BE489901_2_D_2972971SBEREVERSE3262760.1629.638297.85A/C297GAAGATAAAATGTTTTGAACTTACGGA
1047BE489901_2_D_3393391SBEREVERSE3682759.0725.936393.38T/C339ATCCTTGAACTCAAAAAAACAACTTAT
1048BE489901_2_D_3553551SBEREVERSE3842758.5329.636292.69T/C355AGAACTAAATCTTTTGATCCTTGAACT
1049BE489901_2_D_3613611SBEFORWARD3332857.121.437381.52T/C361CTAAAATGATAAGTTGTTTTTTTGAGTT
1050BE489901_2_D_3623621SBEFORWARD3352757.6522.227288.08T/C362AAAATGATAAGTTGTTTTTTTGAGTTC
1051BE489901_2_D_3943941SBEFORWARD3672754.9129.636383.48T/C394TCAAAAGATTTAGTTCTTACTGTAGTG
1052BE489901_2_D_3943942SBEREVERSE4222664.7646.154376.57T/C394GAAATTACAGGACTGAACCTGACGGT
1053BE489901_2_D_4294291SBEFORWARD4042561.63444379.26G/T429GTTCAGTCCTGTAATTTCTTGCCTC
1054BE489901_2_D_5415411SBEREVERSE5682564.53484370.58T/C541TGTGTGTAGAACCAGTCGATTACGC
1055BE489901_2_D_5655651SBEREVERSE5942761.1540.745394.68T/C565TAATCAGTGAAGAGAAGACAGAGTCGT
1056BE490041_1_A_1741741SBEFORWARD1472764.7640.744383.21A/C174TCAGTCTAATTCCTATCGCTTTGATCG
1057BE490041_1_A_1741742SBEREVERSE2032757.8537.048393.56A/C174TGGAGTACATATCTACCTCACCTTTAT
1058BE490041_1_A_2182181SBEREVERSE2482859.55254186.16G/C218CATGTGTCATTTTCTTATTTTATTTTCC
1059BE490041_1_A_6016011SBEFORWARD5742763.1933.335286.89A/T601AAATTATTGGAGTGGGCTAAATCTGAA
1060BE490041_1_D_2902901SBEREVERSE3182650.8326.926364.56T/C290CCAATTCTATTTTAGTAGTATGAGTA
1061BE490041_1_D_3033031SBEFORWARD2762761.3244.445394.17T/C303GTAAAGCTGTGAGCCGTACTCATACTA
1062BE490041_1_D_3033032SBEREVERSE3312658.2130.776386.71T/C303GATCTGAATCGTACCAATTCTATTTT
1063BE490041_1_D_3683681SBEFORWARD3402858.3528.574284.22T/C368GCTATAAATAAATAAAACCTCTGAATGG
1064BE490064_1_D_69691SBEREVERSE982760.0833.334397.27G/T69TGTGGTGATTAGTGTGATTTAGATGAT
1065BE490079_5_D_1291291SBEREVERSE1582764.4240.745384.88G/T129TGTCCTAAACAGCTAAGGTTTTGTGCT
1066BE490085_3_D_3153151SBEREVERSE3422562.31447277.43T/C315CTTGTGGTCTTTAAGAATCCTGGTG
1067BE490147_6_A_2922921SBEREVERSE3212761.2848.156293.26T/C292CTACTACTACGTGCACTCTGACACTGA
1068BE490147_6_B_28281SBEREVERSE572762.537.044288.34G/T28TAATATAGTGCCAGAATGAAACCCAAC
1069BE490149_7_B_3593591SBEFORWARD3322760.5540.746397.09T/C359CATCTCTTCTTGATCAGTCCTGTAACT
1070BE490177_4_B_70701SBEREVERSE992758.7337.044393.68A/T70GACGTATGCAGGAGATAAAATACATAG
1071BE490177_4_B_1091091SBEFORWARD822761.2629.634190.37T/C109TATCTCCTGCATACGTCAAAAATAAAA
1072BE490177_4_B_1271271SBEFORWARD1002758.1729.635392.63T/C127AAAATAAAAGGACAGACTGCAATACTA
1073BE490200_6_B_1711711SBEFORWARD1452664.1242.314378.49T/C171ATATAGCTGTCTCGTTTGGGAACACA
1074BE490200_6_B_1711712SBEREVERSE1982560.38363280.72T/C171GTCACAACATTTCCACCAATAAGAT
1075BE490200_6_D_2902901SBEREVERSE3192764.4137.046283.86T/C290AGCAGAATTCGGTGAAAAAGTCTGTAA
1076BE490200_6_D_7487481SBEREVERSE7772752.3722.225375.23G/T748TACTACATTAACTTGATAGATTCATTT
1077BE490204_2_A_3603601SBEFORWARD3342661.8838.464385.2A/T360GTTGAAGATGCTGTTAAGTCCACATT
1078BE490204_2_A_3743741SBEFORWARD3492556.07325373T/C374AAGTCCACATTTAATAGGTACATGA
1079BE490204_2_D_1371371SBEFORWARD1122563.45404272.16T/C137CATGTGAAGAATTTGGTGGAGTTGT
1080BE490204_2_D_1371372SBEREVERSE1652664.2142.313377.57T/C137ATCATCCAGAGCCATTCTTAGGGTAA
1081BE490219_7_B_3423421SBEFORWARD3152761.0833.336395.5T/C342TCATGAAATGGGGAAGTAGTAATAACA
1082BE490226_6_A_3083081SBEFORWARD2802864.9742.868276.74T/C308TACATGTAGTGTACCATAGCTTGCGCTT
1083BE490226_6_B_2442441SBEREVERSE2712563.06404273.33A/C244AAGTATGCTCACAAGGCCATAATCA
1084BE490226_6_B_4184181SBEFORWARD3912757.2322.226390.43T/C418CATTTTCTTTTAGATTTCATATGTTGA
1085BE490226_6_B_4184182SBEREVERSE4472763.8937.044284.16T/C418CAAGATAACTGGCAATAGCAACAAATG
1086BE490226_6_D_4804801SBEREVERSE5092763.9640.746386.87T/C480GTGAAGCAGATATTCTGTCCCAATCTT
1087BE490304_3_D_3343341SBEFORWARD3072761.1729.634292.32T/C334ATCAGCTTACAAAGAGGAAAAAGAAAA
1088BE490304_3_D_3343342SBEREVERSE3632760.6637.046396.76T/C334TTGTCCTATGTGGACAGTCTTAACTTT
1089BE490350_4_A_53531SBEREVERSE802564.57484268.78G/C53CTCCTACGGCCAGCATTTAACACTA
1090BE490350_4_A_3973971SBEREVERSE4252662.9546.154280.33A/T397CACTATCCTTCCATACTGAGAGCACA
1091BE490384_2_A_3373371SBEREVERSE3662760.9133.334290.52T/C337TTGTCATATCTGTTTTTTTCTACCCTG
1092BE490384_2_A_3643641SBEFORWARD3372759.3633.334291.33A/T364AACAGGGTAGAAAAAAACAGATATGAC
1093BE490384_2_A_4704701SBEFORWARD4432758.1129.636291.42T/C470AGCTTCAGTTTGATTAATAGTTGACAT
1094BE490384_2_A_5445441SBEFORWARD5172764.3329.634382.29T/C544TTTTGTTTTTTCCTTTAATTCTGCACG
1095BE490384_2_A_5525521SBEFORWARD5252762.637.044288.03T/C552TTTCCTTTAATTCTGCACGTAGTGTCT
1096BE490384_2_A_5525522SBEREVERSE5812760.7733.335395.82T/C552GCTCAGCTAAAAATAAATTGGTCTCTT
1097BE490384_2_A_5555551SBEFORWARD5292661.0238.464286.11A/T555CTTTAATTCTGCACGTAGTGTCTTGA
1098BE490384_2_A_5555552SBEREVERSE5822558.28327380.9A/T555AGCTCAGCTAAAAATAAATTGGTCT
1099BE490384_2_A_7007001SBEFORWARD6742660.2138.465390.82T/C700GTCGAAACTTTGTGTATGGAGTTATG
1100BE490384_2_D_3503501SBEREVERSE3792764.9633.333278.1T/C350ACCTGTCGTTTTGTTTTTTCCTTGAAT
1101BE490384_2_D_5325321SBEREVERSE5592563.88363165.77G/T532ATGTGGCAAACAGGGTAGAAAAAAA
1102BE490550_6_D_4044041SBEFORWARD3772760.2733.336296.28T/C404CCTTTAAATCATCTGTAGAAAGGTCAA
1103BE490550_6_D_4044042SBEREVERSE4312562.81486377T/C404GTTCTAGGACAGGATTTCTCTTGGC
1104BE490550_6_D_4954951SBEREVERSE5222564.45483370.2T/C495GCTTTTCCCTGTCTGTCTTCTCTGA
1105BE490550_6_D_5005001SBEREVERSE5272564.03444168.75G/C500ATCATGCTTTTCCCTGTCTGTCTTC
1106BE490550_6_D_5015011SBEREVERSE5282564.85445166.91A/C501CATCATGCTTTTCCCTGTCTGTCTT
1107BE490550_6_D_5165161SBEREVERSE5432560.42405383.52T/C516CTCTTCTTTGACTCTCATCATGCTT
1108BE490599_4_A_1321321SBEFORWARD1052764.2144.446386.12T/C132TTGCTGTTTCTATAGCTAAGGCTGGAG
1109BE490599_4_A_1321322SBEREVERSE1612753.3825.935276.6T/C132AGTATCATAACCTAATAACAAAGAAAG
1110BE490599_4_D_2892891SBEREVERSE3182761.7237.045392.97T/C289GTCTGTAACGACATATTCTGGTGAAAA
1111BE490604_6_D_3513511SBEFORWARD3252664.1542.314378.38T/C351GACATCGACAATCTGAAGAAGCTCAT
1112BE490643_7_A_1031031SBEFORWARD762761.6733.337394.37G/C103TAAATATTCTCAGAAGCCCTGATTGTT
1113BE490643_7_A_1031032SBEREVERSE1322760.2429.634193.44G/C103GCTCATCAATATAAAGTCAAAAGGAAA
1114BE490643_7_B_2152151SBEFORWARD1892664.0542.313276.4G/C215ACACCATCACCATCACGAATAACTCT
1115BE490643_7_D_85851SBEFORWARD592663.5634.623274.78G/T85AGAAGCCCTGACTGTTCATTTTTTTT
1116BE490643_7_D_85852SBEREVERSE1142759.833.334396.9G/T85AAATATAGTGGCTCGTTAATATGCAGT
1117BE490643_7_D_3923921SBEREVERSE4212764.2540.742281.82T/C392AGTTATTCGTGATGCTGTCCGTAGATT
1118BE490651_3_A_5035031SBEREVERSE5322764.2140.744384.87T/C503GAAGCCAGAGATATTTTACCTGCAATG
1119BE490651_3_A_7057051SBEREVERSE7342764.744.444281.73T/C705CTCATCTACCAAGGTTATTTCGGGAGT
1120BE490651_3_A_7437431SBEFORWARD7162761.6537.044392.55T/C743ATAACCTTGGTAGATGAGCATTGTCTT
1121BE490651_3_A_7647641SBEREVERSE7912561.88486379.77T/C764CTGTATACTGGAACCATCACCACTG
1122BE490651_3_A_100410041SBEREVERSE10332763.3433.335388.1A/T1004ACAATTAAATATGCTCCATGCAAACAG
1123BE490651_3_A_102710271SBEFORWARD10002761.1829.635394.57A/T1027TATTAACTGTTTGCATGGAGCATATTT
1124BE490651_3_A_102710272SBEREVERSE10562761.9533.337393.52A/T1027ACAACAAGTGGAACGTTAATAACACAA
1125BE490651_3_D_6726721SBEREVERSE7002664.5746.153376.51T/C672CAAGGTTATTTCGGGAGTAGCAGGTA
1126BE490658_4_A_99991SBEFORWARD722761.8844.444391.85T/C99CCATCTATCCTTCACCACAGGTACTAT
1127BE490658_4_A_99992SBEREVERSE1282756.3529.632080.3T/C99ATGAAAAGTAAATAAATAGAGAGGGAG
1128BE490658_4_B_1551551SBEFORWARD1262957.3827.594376.29G/T155CCCTCTCTATTTATTTACTTTGGATATTA
1129BE490658_4_B_1551552SBEREVERSE1842756.9625.936389.64G/T155TCAAAATTTATAGTGACTTAGGACAAA
1130BE490658_4_B_1561561SBEFORWARD1292751.722.224372.6A/C156TCTCTATTTATTTACTTTGGATATTAG
1131BE490658_4_B_1561562SBEREVERSE1862859.3932.146390.26A/C156GGTCAAAATTTATAGTGACTTAGGACAA
1132BE490658_4_B_1591591SBEFORWARD1322753.0222.224376.55G/T159CTATTTATTTACTTTGGATATTAGCTT
1133BE490658_4_B_1591592SBEREVERSE1882758.7229.636394.92G/T159TTGGTCAAAATTTATAGTGACTTAGGA
1134BE490744_3_A_36361SBEREVERSE652759.7333.332192.12T/C36ACTACAACAAGCACAAGAAATAACTCA
1135BE490744_3_B_3303301SBEFORWARD3032763.8540.746387.2T/C330AAGTTCTTGTGCATCGGGTAATTAGAG
1136BE490763_2_A_91911SBEFORWARD642757.6829.638291.38T/C91TGTTAATATATGGAACATCACTTTGTC
1137BE490763_2_A_91912SBEREVERSE1202762.5740.747391.67T/C91AAGTTAAACTCATACTCCCTCCCGTAA
1138BE490763_2_A_1481481SBEREVERSE1772764.5440.745384.51A/C148ACCCGATGAGTCAAAACAGTTAAACAC
1139BE490763_2_A_3583581SBEREVERSE3852551.1205254.02A/T358AATTCTAATACAGAACTACAAAAAA
1140BE490763_2_B_1711711SBEFORWARD1442764.8533.334382.94T/C171TTGTCATGTGATTTCCATAATTTGTCG
1141BE490763_2_B_1711712SBEREVERSE1982557.74323275.09T/C171TTTTCAGGTTACAGAGATAGCAAAT
1142BE490763_2_B_3833831SBEFORWARD3582561.69365379.71T/C383CAAGAAATGACTTTTGTGTCCTTCA
1143BE490763_2_B_4144141SBEREVERSE4412560.83406281.27T/C414CAATTGATACTACACGGTTAATGGC
1144BE490763_2_B_8668661SBEFORWARD8392758.5529.635292.11T/C866TATGACAACTGATTTTGTGACATTTAC
1145BE490763_2_B_8668662SBEREVERSE8932564.18446372.89T/C866TTGTAACTCCTGCAGCCATACTTCA
1146BE490763_2_D_7187181SBEFORWARD6912758.1329.634290.21A/C718ATAATTTTCAGGTTACAGAGATAGCAA
1147BE490763_2_D_7187182SBEREVERSE7472763.7237.044284.68A/C718GTCATGTGATTTCCATAATTTGTCGTC
1148BE490786_6_D_72721SBEREVERSE1012759.8733.333396.48T/C72AACAGGATAGAAAAGAATAAGGTGACA
1149BE490786_6_D_4894891SBEREVERSE5182762.0433.332186.79T/C489AAATGAACAAGACAAATAAAGAGCACC
1150BE490786_6_D_5955951SBEREVERSE624276344.444286.84T/C595GAAAGAGACCAAGGAAGAAAGGTACAG
1151BE493868_7_A_93931SBEREVERSE1222761.8337.045290.96T/C93TACAAAAATTACACTCAGAGAACCACG
1152BE493868_7_B_1851851SBEFORWARD1582761.0425.935395T/C185TAAAATTATTGCAGATTTGATCCATGT
1153BE493868_7_B_1851852SBEREVERSE2142757.733.336290.2T/C185ATACAACTCGAGATTTTCTACTATTGG
1154BE493868_7_B_3113111SBEFORWARD2852663.4638.464278.77G/T311AATCCTATGCTTGATCCTTGAACCTT
1155BE493868_7_B_3113112SBEREVERSE3382564.42446270.5G/T311GGATGATGGCATGACAGAATGTAGA
1156BE493897_7_B_94941SBEREVERSE1232763.144.444388.2G/C94ACGAGAGGAGTAAGAGAGTGGATCATT
1157BE493897_7_D_1461461SBEREVERSE1732564.15366271.31T/C146TGCGCATTATCAAGAAGAAACAAGA
1158BE494023_4_D_1941941SBEREVERSE2232759.7629.635397.41T/C194ACAAAGAATGAATTACAGTGGAAGAAT
1159BE494028_7_D_2812811SBEFORWARD2552664.1646.154276.69T/C281ATTCTAGTGTCCAAGGAAGAAGGTGC
1160BE494051_4_D_2532531SBEREVERSE2822757.7837.044289.17A/T253TCTTATCTTTCTGGTAAGGAACTACAC
1161BE494189_6_D_1871871SBEFORWARD1622564.45484370.81T/C187CAGCTTCATGTTTGAGGTGAGACAC
1162BE494262_2_D_84841SBEREVERSE1112562.02446379.36T/C84CAAGAGCAGACCTCTGAAAAAGTTC
1163BE494426_5_B_3643641SBEFORWARD3372764.6737.046382.52A/T364TGTCACTATGCTACCATTTTTTGGTCA
1164BE494426_5_D_3863861SBEFORWARD3592764.2140.746386.12A/C386CATGATCAGGCTTCTTTGGTTTATAGC
1165BE494426_5_D_4094091SBEREVERSE4382759.5533.335295.12T/C409GCCTTTGAATAAACAGATTAGATGACT
1166BE494474_3_A_3763761SBEREVERSE4062858.9632.146388.95A/T376CATATGTTAGTTTGCTGTGCTATTTAAG
1167BE494474_3_A_5465461SBEFORWARD5192760.933.334394.8A/C546TTACAATTATGGAGGTTACTTTTGCAG
1168BE494474_3_B_1861861SBEREVERSE2152763.8233.336387.28T/C186AAATTAATGCCCAAACCTACAGTTCAA
1169BE494474_3_D_99991SBEREVERSE1262564.81446269.31G/C99GCTCAAGATCTGATAAGCAAACCCA
1170BE494474_3_D_6196191SBEREVERSE6482764.3937.048386.83G/C619GACCAATTTGTTGGTCCTTTTTAGACA
1171BE494538_6_A_90901SBEFORWARD652562.15444377.71T/C90GTCAATAGTAGCAGATTGGGGTTTG
1172BE494538_6_A_4314311SBEFORWARD4062563.7404373.08T/C431AGAAGGATGCTCTGGAAAGTTCAAA
1173BE494538_6_A_4314312SBEREVERSE4582562.91444273.77T/C431CTCAATCTCGGGAAGTAGATGTTCA
1174BE494538_6_A_4834831SBEFORWARD4582561.62483175.35A/C483GAAGGTGAGTTGTCTCTCTGTGTTG
1175BE494538_6_A_4834832SBEREVERSE5122761.833.335189.39A/C483CATCAAAACAGTCAGACCAAAGAATAA
1176BE494538_6_B_4264261SBEREVERSE4542659.8438.463285.36T/C426CACAGACTAAAAAAACTACAGAACGC
1177BE494538_6_B_4294291SBEREVERSE4582759.8329.634292.74T/C429TTTGCACAGACTAAAAAAACTACAGAA
1178BE494538_6_D_5325321SBEFORWARD5052763.2433.335286.75T/C532TGCATAATTCTTTGGTCTGACTGTTTT
1179BE494538_6_D_5325322SBEREVERSE5612764.6633.335384.14T/C532TACAGAACACACGATTTGGAAAATTCA
1180BE494538_6_D_5345341SBEFORWARD5072761.833.335291.06T/C534CATAATTCTTTGGTCTGACTGTTTTGA
1181BE494538_6_D_5575571SBEFORWARD5322562.83365376.3T/C557GATGAATTTTCCAAATCGTGTGTTC
1182BE494538_6_D_5685681SBEFORWARD5412763.3337.043285.2T/C568TCCAAATCGTGTGTTCTGTAGTTTCTT
1183BE494765_4_B_34341SBEREVERSE632764.0137.046285.04A/T34ATGGAGCAGCATATGACTCAATACAAA
1184BE494765_4_B_3473471SBEFORWARD3202761.4425.934393.18T/C347CAACAAGCCATGAATGAATTAAAATAA
1185BE494765_4_B_4264261SBEFORWARD3992764.7337.044281.65T/C426ACACGAGTATCAACCCATTTTTCACAT
1186BE494765_4_B_4904901SBEFORWARD4632758.5433.334291.44T/C490GCTATTTATGTAGTTTGACCAAGAAGA
1187BE494765_4_D_1361361SBEFORWARD1092757.3929.636289.25G/C136TTATTTGTATTAAGTCATATGCTGCTC
1188BE494765_4_D_4974971SBEFORWARD4702761.6929.635393.06T/C497AAAAACACAAGTATCAACCCATTTTTC
1189BE494765_4_D_5655651SBEFORWARD5382762.0837.044289.6T/C565GCTATTTATGTAGTTTGCCCAAGAAGA
1190BE494807_3_A_7637631SBEREVERSE7922764.1540.747386.93A/C763ACTCACAAAGTGAGAAAGCACATTCAG
1191BE494848_4_D_1121121SBEFORWARD852763.9337.044284.06T/C112TATACAGCCTTTTAATGCCAACACCTT
1192BE494848_4_D_1811811SBEREVERSE2102759.1537.043292.66G/T181AAGATAGTTCAGAGGGTAGACACAAAT
1193BE494848_4_D_2982981SBEFORWARD2732563.03326376.33T/C298ATCTTGAAATGCCTTGCCATATTTT
1194BE494848_4_D_6506501SBEFORWARD6252563.11444273.18T/C650ACCCTCAGCTTTTCAAGTCTATTGG
1195BE494850_1_D_1401401SBEREVERSE1692758.0533.333289.35T/C140CCTTGTATTTTTCTCTGAATCTATCAC
1196BE494910_4_D_95951SBEREVERSE1232662.946.157282.34T/C95GTACTGCCAGCACTTGTGTGTAATCT
1197BE494910_4_D_1111111SBEFORWARD862564484168.84T/C111GTGTCGGTTCCAGATTACACACAAG
1198BE494910_4_D_1411411SBEFORWARD1162562.47484376.77G/C141GCAGTACCTCCAGTGATTGTTAAGC
1199BE494910_4_D_1451451SBEFORWARD1182763.644.444285.03A/C145AGTACCTCCAGTGATTGTTAAGCCTGT
1200BE494910_4_D_1461461SBEFORWARD1192762.8744.444388.9A/C146GTACCTCCAGTGATTGTTAAGCCTGTA
1201BE494910_4_D_1501501SBEFORWARD1232763.0644.444388.32T/C150CTCCAGTGATTGTTAAGCCTGTACTGT
1202BE494910_4_D_1521521SBEFORWARD1272560.82444280.03T/C152AGTGATTGTTAAGCCTGTACTGTGG
1203BE494910_4_D_1561561SBEREVERSE1852763.8548.156387.2A/T156GACCCTGTAAGTAGCACTCGTACAACA
1204BE494910_4_D_2582581SBEREVERSE2882859.7832.144390.18T/C258GCCTAAAATCAGTAGAAAATATCCTTGT
1205BE494921_3_A_68681SBEFORWARD412763.7333.338287.13T/C68AAATTCATCTATGAGGAAATTGCGAAG
1206BE494921_3_D_28281SBEFORWARD32564.03444168.75T/C28GGAAGCTCTTGAGAATGGTGAATGT
1207BE495008_6_B_1701701SBEFORWARD1452563.21404272.87T/C170ATCAAGCCTGGTACATCAATTTCCT
1208BE495008_6_D_1141141SBEFORWARD892563.9446373.7T/C114CTTCGTTGATATCTGCCTTCCAGTT
1209BE495116_4_A_2392391SBEREVERSE2682755.5125.933383.42T/C239AAGAATAAACACAAACAGAAGAACTAT
1210BE495116_4_A_6246241SBEREVERSE6512564.6445370.98T/C624GAAAAGCCACAACCCAAGTAACTGA
1211BE495116_4_B_6976971SBEFORWARD6712663.942.315278.1T/C697CAGTTACTTGGCTTGTGGCTTTTCTA
1212BE495143_6_A_7547541SBEREVERSE7822663.434.627280.85T/C754GTAAATTGACGATTTTCTTTCCACCA
1213BE495175_3_A_3173171SBEREVERSE3442556.88327275.03T/C317TATAGAGCATTATGCAATCTTCAAC
1214BE495277_5_A_4274271SBEFORWARD4022562.75405376.56T/C427CATGCTGTATGGTTTGGGATTTAAG
1215BE495277_5_A_6676671SBEFORWARD6412664.442.314275.97T/C667TCTAACATAAGGATGGTGTTTGTCGC
1216BE495277_5_B_42421SBEREVERSE692561.75328276.15G/T42CGATGCTAGATCGGAAAAAAAAATA
1217BE495277_5_B_6436431SBEFORWARD6162756.4629.634285.2G/T643TTCATTGTGTTGTACTCTAGTCATTTA
1218BE495277_5_B_6646641SBEFORWARD6382660.3934.628392.18G/C664ATTTAGAAGGCTTTCTCATTGTGTTC
1219BE495277_5_D_3673671SBEREVERSE3952658.3134.624385.77T/C367TGTAGTGATGGAAACAAGCTATACAT
1220BE495277_5_D_3823821SBEFORWARD3562659.842.314390.24A/T382GTGGTTGACCTGTATGTATAGCTTGT
1221BE495277_5_D_3823822SBEREVERSE4102663.6242.313379.34A/T382AAGCGTTCCAAGTTATGTAGTGATGG
1222BE495277_5_D_6506501SBEFORWARD6232761.8633.335290.88T/C650CATTATGTTCAGCTTGGGATTTATCTT
1223BE495277_5_D_6666661SBEREVERSE6952757.329.634287.73A/T666ATGATAAGACTCCAGTTAGTTGTTTTT
1224BE495304_3_A_1701701SBEREVERSE1972563.7404373.08T/C170AAACTGCCATTCAAGAAAGAGGAGA
1225BE495304_3_B_1011011SBEFORWARD742763.5537.046286.43T/C101CTATTCATAAATCAGGTGCCTTTCCAT
1226BE495304_3_B_3013011SBEFORWARD2742761.633.336393.96T/C301TGACCTGACTGATTTAAAGAGTTTTCA
1227BE495304_3_B_3013012SBEREVERSE3292662.9938.464381.86T/C301ATTCAAGAAAGGGGAGACGATTTAAC
1228BE495325_7_D_2342341SBEFORWARD2072760.6533.335396.17T/C234GTTTCATCATGCTACTGTTGTGATTTA
1229BE495325_7_D_2962961SBEFORWARD2692757.7525.938291.57G/T296ACATATAATTATCCAACAAAACGAAGT
1230BE495325_7_D_2972971SBEFORWARD2702759.2529.638296.07A/T297CATATAATTATCCAACAAAACGAAGTG
1231BE495542_1_A_3013011SBEFORWARD2742759.4929.634294.3T/C301AAATTAACCAAGAAAAGTTGTGAAGAC
1232BE495542_1_D_2722721SBEFORWARD2452761.0129.634394.47G/T272AGCAAGAAATTAACCAAGAAAAGTTGT
1233BE495542_1_D_2722722SBEREVERSE2992564.57524268.79G/T272CTGCTGAGTGCTCTTATCTCGGTCT
1234BE495786_1_A_1191191SBEFORWARD922756.9125.934388.24G/T119TAAAAGGAACATTAAGAGAATGATACA
1235BE495786_1_A_1191192SBEREVERSE1482754.7625.936383.04G/T119CTAAAAATAAGGTTAGTTCTTTCTTGT
1236BE495786_1_B_128512851SBEFORWARD12582763.4229.637285.22T/C1285AAAAAAGTTTTCTGTTTTCTTGGGGTT
1237BE495786_1_D_34341SBEFORWARD72758.6925.938396.06T/C34CCTAAATATTTTGATTGCCTCTTTAAT
1238BE495786_1_D_34342SBEREVERSE632756.1629.634385.97T/C34TGTATCATTCTACGTTCCTTTTATACT
1239BE495790_5_A_5875871SBEREVERSE6142564.6485371G/T587CCATCCCTCTATTCTGGCAGTGTTA
1240BE495790_5_B_3703701SBEFORWARD3442664.7346.154274.98T/C370GATCCAGTTCTTACCGCGTTTGTAGT
1241BE495790_5_B_3703702SBEREVERSE3992756.9529.634388.34T/C370AGAATCAAGTTATACGACACAACTAAA
1242BE495790_5_D_3723721SBEREVERSE4012754.8922.228384.66G/T372TAGAAAAGTCAATTGTATTATCAACAT
1243BE496826_6_D_2812811SBEREVERSE3102758.4440.745393.45A/C281GAGATGTATGTTACTGACAGAGGAAGT
1244BE496826_6_D_2992991SBEREVERSE3282757.7329.633390.06A/C299AAAGAAAGGATAGGAAAAGAGATGTAT
1245BE496826_6_D_3003001SBEFORWARD2732763.4444.445387.8T/C300GTCTGCTCAAACTTCCTCTGTCAGTAA
1246BE496826_6_D_3003002SBEREVERSE3292759.6433.332293.5T/C300CAAAGAAAGGATAGGAAAAGAGATGTA
1247BE496826_6_D_3033031SBEREVERSE3322760.6633.332292.61T/C303CAACAAAGAAAGGATAGGAAAAGAGAT
1248BE496826_6_D_3123121SBEFORWARD2852758.8937.045293.13T/C312TTCCTCTGTCAGTAACATACATCTCTT
1249BE496826_6_D_3123122SBEREVERSE3402662.3438.464180.47T/C312GGATCAAACAACAAAGAAAGGATAGG
1250BE496826_6_D_3203201SBEFORWARD2932756.4933.336286.55A/C320TCAGTAACATACATCTCTTTTCCTATC
1251BE496826_6_D_3203202SBEREVERSE3472563.44365171.15A/C320GATGAACGGATCAAACAACAAAGAA
1252BE496826_6_D_3273271SBEFORWARD3002758.8133.333189.98T/C327CATACATCTCTTTTCCTATCCTTTCTT
1253BE496826_6_D_3283281SBEFORWARD3012757.7329.633186.73G/C328ATACATCTCTTTTCCTATCCTTTCTTT
1254BE496826_6_D_3313311SBEFORWARD3042760.6633.332190.94G/T331CATCTCTTTTCCTATCCTTTCTTTGTT
1255BE496826_6_D_3363361SBEFORWARD3092761.6833.332187.88T/C336CTTTTCCTATCCTTTCTTTGTTGTTTG
1256BE496826_6_D_3363362SBEREVERSE3632563.63365170.57T/C336GATTGATTGAATGATTGATGAACGG
1257BE496826_6_D_3383381SBEFORWARD3112761.5729.633392.16T/C338TTTCCTATCCTTTCTTTGTTGTTTGAT
1258BE496826_6_D_3663661SBEREVERSE3942663.534.624380.32G/C366GTTTCATTTCAATCTCCGATCAATGT
1259BE496826_6_D_3683681SBEREVERSE3952564.38364371.03T/C368CGTTTCATTTCAATCTCCGATCAAT
1260BE496826_6_D_3703701SBEFORWARD3442664.4134.625378.22T/C370ATCAATCATTCAATCAATCGCTGAAC
1261BE496826_6_D_3723721SBEFORWARD3472562.94325375.97A/T372AATCATTCAATCAATCGCTGAACAT
1262BE496826_6_D_4304301SBEREVERSE4572562406176.07T/C430CAGACAAGAACAGAGACGTCAAAAA
1263BE496863_7_A_9359351SBEREVERSE9622564.64444166.93T/C935ACATCAAAACGCGAGATCCACTTAC
1264BE496863_7_B_7187181SBEFORWARD6922662.6238.464382.98T/C718CCAAGATCCTCATTGTATGTTTGAGA
1265BE496863_7_D_3933931SBEFORWARD3662760.1837.044396.95A/T393ACTCCTAAGATCCTCATTGTATGTTTG
1266BE496976_5_D_1971971SBEFORWARD1722562.92444375.41T/C197CCGAGACTGAAAGAATGTGGTCTTA
1267BE496986_6_A_1101101SBEREVERSE1392761.2848.156293.26T/C110CTACTACTACGTGCACTCTGACACTGA
1268BE496986_6_A_2892891SBEFORWARD2622760.8629.638293.54T/C289AAGATCGATTTTTTAGTTGTATTGGCT
1269BE496986_6_A_2892892SBEREVERSE3182760.9237.045395.35T/C289CTTCGATACCATGTAGAAGTGCATATT
1270BE496986_6_A_2922921SBEFORWARD2652759.8729.636396.13T/C292ATCGATTTTTTAGTTGTATTGGCTAGA
1271BE496986_6_A_2922922SBEREVERSE3192562.77445376.48T/C292GCTTCGATACCATGTAGAAGTGCAT
1272BE496986_6_A_4314311SBEFORWARD4052662.2446.154282.44T/C431GAGGAGGAGTGTTGACGTATAATGTG
1273BE496986_6_B_77771SBEREVERSE1062762.537.044288.34G/T77TAATATAGTGCCAGAATGAAACCCAAC
1274BE496986_6_B_84841SBEREVERSE1112560.7406179.99T/C84CTCGGTAATATAGTGCCAGAATGAA
1275BE496986_6_D_2022021SBEREVERSE2292560.87407383.44G/T202TAGAACAACCAGGCTGTGATTTTAG
1276BE497160_4_D_73731SBEFORWARD482563.88484169.19T/C73CAGATACTAACATCCATCGCACCAC
1277BE497160_4_D_1271271SBEFORWARD1002760.3529.637398.32T/C127ACATGAATTATGAATGTCTGGAAGAAT
1278BE497160_4_D_1271272SBEREVERSE1562761.1244.445394.77T/C127AAGCTATGAGACCGATAGTACCCTAGA
1279BE497169_3_D_3463461SBEREVERSE3732563.34404272.47T/C346CATGCCGTAAAACAGATAGTTTCCA
1280BE497177_1_A_4324321SBEFORWARD4052760.1129.636296.77G/C432ATTAAAACTAATTGTTGGTCAAAGCAC
1281BE497177_1_A_4624621SBEREVERSE4892556.6368173.14T/C462CTAATTAGTACTCCCTCCTTTTTCA
1282BE497184_4_A_1091091SBEFORWARD822760.0137.045296.44T/C109AGGATAACTAAAGACTCAAGTGGAACA
1283BE497184_4_A_1091092SBEREVERSE1382761.0933.334394.22T/C109AGGTAGCATTAGCAAGTTAAGCAATTT
1284BE497184_4_A_3393391SBEFORWARD3122758.5129.636394.27T/C339TTTGTTACCATTCTAACTTTTAAGACG
1285BE497184_4_B_2582581SBEFORWARD2312759.4633.336295.45G/C258AGTGTGCATCATGAGTAAGTGATATTT
1286BE497184_4_D_3133131SBEFORWARD2872654.530.777376.21T/C313CCGTATTTGGTATTACTTACTACATT
1287BE497184_4_D_3133132SBEREVERSE3412655.3326.926378.06T/C313GTGTTAAAAGTTAGAATGGTAACAAA
1288BE497213_6_D_2972971SBEFORWARD2702764.5140.745384.59G/T297TGCAGTTATTGATGGCTTGAAGTACAC
1289BE497224_4_A_41411SBEFORWARD142757.1822.226390.28A/T41ATGCCTTTATGTTTTCTAATATTCATT
1290BE497224_4_A_1871871SBEREVERSE2152662.5534.626384.43T/C187CTTTTGGTGGTTCAAAAGTATCCAAT
1291BE497224_4_A_1891891SBEREVERSE2162564.38406372.29T/C189GCTTTTGGTGGTTCAAAAGTATCCA
1292BE497224_4_A_3573571SBEFORWARD3302760.229.636192.61T/C357TCTTTTTTCAGCTATGCATCTTTACTT
1293BE497224_4_A_6416411SBEREVERSE6702752.0125.934373.52T/C641AACTAATAATACACTTATCCTACATTG
1294BE497224_4_A_7537531SBEFORWARD7262759.9829.632192.86G/T753TGTTGACTATCCTATTTTTCTTTGCTT
1295BE497224_4_B_3273271SBEREVERSE3562758.5325.934393.08T/C327AAAATTAGAAGGTGCAGTTAGAAAAAT
1296BE497224_4_D_1481481SBEFORWARD1212764.4633.335283.07T/C148TTTGAAATTGGGTGTGTAATATGCCTT
1297BE497224_4_D_1481482SBEREVERSE1772751.7822.227273.05T/C148AGACTAGATAATGAATATTAGAAAACA
1298BE497224_4_D_2632631SBEREVERSE2902564.43444370.87T/C263ATCTATGAAGACACACGAGCTGCAA
1299BE497238_5_B_3273271SBEREVERSE3552663.1642.314279.69T/C327AGCGTCAGCTAATCGTCTTAATCATC
1300BE497238_5_B_3853851SBEFORWARD3582760.837.045395.72A/T385CAAGTTGTATCATTCTGACTACGTGAA
1301BE497238_5_B_3853852SBEREVERSE4142762.637.044288.05A/T385CTGAAAATAAGTGCATGACCACTAACA
1302BE497238_5_B_4214211SBEREVERSE4502761.4437.048395.68T/C421ATATATATGCAAGGAGCTGCAGTGTAA
1303BE497361_1_A_2652651SBEREVERSE2942760.7137.045396.01T/C265GACTAATAATTGCCTTCAGAACATCAG
1304BE497361_1_B_2472471SBEFORWARD2202763.6637.046286.11T/C247CTTGCATGCTGCTAATTTAATCCCTAT
1305BE497361_1_D_2132131SBEREVERSE2412663.9934.626278.45T/C213ATTAAATTAGCAGCATGCAAGGAACA
1306BE497368_5_D_5185181SBEREVERSE5452561.91364276.78A/C518GGCCAAAATTAAAGAGGGATAGAAA
1307BE497469_3_B_2182181SBEREVERSE2472762.5937.045288.7T/C218GATCAGGTTAATAATGTATCGAAGCCA
1308BE497494_2_A_3293291SBEREVERSE3582763.1429.637288.28T/C329TTTATTAAAATGCAACTCCTTCAGCAA
1309BE497494_2_A_3833831SBEREVERSE4102552.6247363.83G/T383TATTTCAGCAATAAACAGTAAGATA
1310BE497494_2_A_4754751SBEFORWARD4502560.04366385.3G/C475AAATAATCCTGAGATGTCAAAGCTG
1311BE497494_2_B_1301301SBEREVERSE1592760.7522.226292.63A/C130AAAAAATCATATTGGATTAAAATTGGC
1312BE497494_2_B_4604601SBEFORWARD4332758.7825.935392.25T/C460TAAAAAATGCTTACATCTTAACGTGAT
1313BE497590_2_B_27271SBEFORWARD22561.92326277.99T/C27CAAAACAAAATCATGTGATGGGATA
1314BE497590_2_B_6446441SBEFORWARD6172756.2322.226387.44T/C644TGACATTAATTTTCAAGTCTTTTATCT
1315BE497590_2_B_6446442SBEREVERSE6712559.78363179.55T/C644CACAAGTTTATTTAGCACAACGAGA
1316BE497701_6_B_5615611SBEFORWARD5332857.3932.146384.25T/C561GCCAATATAGTGATAGAGTTTTATTCAG
1317BE497701_6_B_5615612SBEREVERSE5902756.0725.936183.63T/C561AGAATCTAATAAGAAGAATAGGGAAAA
1318BE497701_6_D_77771SBEFORWARD502757.522.226391.25T/C77ATTAATACCTTTTAAATTTGGACCTTT
1319BE497701_6_D_6266261SBEREVERSE6552760.7333.335395.93T/C626AGGAAAACACTGAGCAAAATACTATCA
1320BE497701_6_D_7647641SBEFORWARD7382660.5434.624287.54T/C764CACTGTAGGTGCATTATTTTGATTGT
1321BE497701_6_D_7647642SBEREVERSE7932760.8933.334293.16T/C764GATACATCAAACAATACGGAAAAGAGA
1322BE497740_3_A_1851851SBEREVERSE2132650.7226.928263.83G/C185TATAATACTATAATCAAACCGTAGAC
1323BE497740_3_D_1871871SBEREVERSE2142557.23286377.11T/C187GAATTCAAGCAAATCAATATCTTCT
1324BE497740_3_D_2122121SBEFORWARD1852758.825.934393.91T/C212TGTTAGAAGATATTGATTTGCTTGAAT
1325BE497740_3_D_2362361SBEFORWARD2092762.9437.045287.65T/C236AATTCTGGATTCAAGTGTTTGACTGAC
1326BE497740_3_D_2362362SBEREVERSE2652756.1629.634182.64T/C236ACACTATAATCAAACCGTAGATAGAAA
1327BE497740_3_D_2432431SBEFORWARD2172663.6438.465278.86T/C243ATTCAAGTGTTTGACTGACGCTTTCT
1328BE497740_3_D_2432432SBEREVERSE2722753.9625.938381.87T/C243AATTATAACACTATAATCAAACCGTAG
1329BE497740_3_D_2452451SBEFORWARD2182763.5437.045285.84G/C245TTCAAGTGTTTGACTGACGCTTTCTAT
1330BE497740_3_D_2452452SBEREVERSE2742756.6925.938390.06G/C245TCAATTATAACACTATAATCAAACCGT
1331BE497740_3_D_3093091SBEREVERSE3382764.7744.445282.15T/C309CAGGCGGTAGCATCTCCTTAATAATCT
1332BE497820_5_A_3973971SBEREVERSE4262764.8448.153280.69T/C397GAACGGAGGGAGTAACAAACTACAGGT
1333BE497820_5_B_1781781SBEREVERSE2072763.7437.045285.25T/C178AAACATAAGGCACTACCATTGGGATAA
1334BE497820_5_D_4194191SBEFORWARD3922762.6540.745186.85T/C419CCATTGGTATGTTTATCCTCTGTGTCT
1335BE497820_5_D_4194192SBEREVERSE4482756.3240.746387.7T/C419AATACGTAGTGGTAGAGACACTAGAGA
1336BE497820_5_D_4674671SBEFORWARD4402763.540.746184.92T/C467TACGTATTTTGTATGCTGTGAGCTGTG
1337BE497820_5_D_4684681SBEFORWARD4412764.1640.744283.35A/T468ACGTATTTTGTATGCTGTGAGCTGTGT
1338BE497820_5_D_4874871SBEREVERSE5142564.46363164.02A/T487AACCGCAAAAAAAGCCTAAATGTTC
1339BE497820_5_D_5645641SBEFORWARD5372763.8848.153283.58T/C564CTGGGACCTGTAGTTAGTTTAGGGGAT
1340BE497820_5_D_8348341SBEFORWARD8072764.9948.156383.77T/C834TAGTAGCAGAGAATATCTCACCCAGCG
1341BE497845_7_A_2702701SBEFORWARD2432760.6329.636193.52A/T270TTTAATGTTTGTACACTGCCTTTTTCT
1342BE498323_7_A_3313311SBEFORWARD3042758.6933.336290.18G/C331ATACGACATAGGTAGTTTTTTTTCCTC
1343BE498323_7_A_3313312SBEREVERSE3592664.4238.467379.44G/C331AACCACAAAAGTTCTGTCAAAGCTCA
1344BE498323_7_B_1461461SBEFORWARD1192759.6333.335397.01T/C146GTTGGTTGATTTATCTTAACTCCATTC
1345BE498351_6_D_1371371SBEFORWARD1102761.9433.334391.68T/C137AAGGCTCTTCTTTATGTCTTGTTTCAA
1346BE498419_6_A_3803801SBEREVERSE4092762.0233.334391.43G/T380AATGCCCTTTTTGGTAAATATAGCTTC
1347BE498419_6_A_4964961SBEFORWARD4692763.7937.045285.08T/C496TAACCAGTGATGTTCCACTTTTTACCA
1348BE498419_6_A_4964962SBEREVERSE5232563.45402169.22T/C496GCATTCCAAACAAGGTCTAACAACA
1349BE498419_6_B_5815811SBEFORWARD5562564.4486372.22T/C581CCTAATGGTGTTCTTCTGGAAGCTG
1350BE498419_6_B_7787781SBEFORWARD7532564.99445268.16T/C778GGGCACCTAAATCATTGGGTAACAT
1351BE498419_6_B_7787782SBEREVERSE8062663.542.316279.91T/C778CTATACGAACTGCAGGGATAAAACCA
1352BE498419_6_D_5475471SBEREVERSE5762755.0829.638385.23T/C547AATATAGCTTACATATTAGTTATGGGG
1353BE498419_6_D_6416411SBEFORWARD6152664.4934.625276.31A/C641ATATTTTGACCACGTCATTGGGATTT
1354BE498419_6_D_6416412SBEREVERSE6702759.0237.044394.57A/C641TAGTGGAACATCACTGGTTAATAGAAC
1355BE498419_6_D_8208201SBEREVERSE8492764.9144.446282.37T/C820GTGGCTTAGAGCTGAAAGAACCACATA
1356BE498566_2_D_2632631SBEREVERSE2922762.3133.335289.53T/C263AAAGAATATCAGATGCCACCAAAACTA
1357BE498662_7_A_3633631SBEFORWARD3382558.61408382.5T/C363GAAGTAGCTGGCCAAGTTAGTTTAT
1358BE498662_7_B_20201SBEREVERSE482661.5630.778388.64T/C20ACAATAACAGAAATTGTTTTTGGTGC
1359BE498662_7_B_6016011SBEFORWARD5762564.96445369.92T/C601GTATTCCTGGATTTACCCCCACAAA
1360BE498662_7_B_103610361SBEFORWARD10092763.8137.044284.42T/C1036TTCATGGTTCAGATGATGATTTCTCTC
1361BE498662_7_B_122912291SBEFORWARD12022762.2533.336391.99A/T1229TTACACTAGTCAACATTTGCATTGCTT
1362BE498662_7_D_43431SBEFORWARD162762.6540.746289.12G/T43TCCGACTCCTAGCAGATTCATTAGATA
1363BE498662_7_D_69691SBEFORWARD432657.2434.626383.8T/C69TCAACTTCTTAGCTACAAATCAGACT
1364BE498662_7_D_69692SBEREVERSE972664.3638.465378.39T/C69CTTGCCAATAGTAAATGAATCTGCCA
1365BE498662_7_D_5215211SBEFORWARD4932859.3935.714388.99T/C521CAAGAAAAGTGTCCTAATTCTGATAGAG
1366BE498730_2_D_1231231SBEFORWARD962760.1440.745397.7T/C123GATTGCTAGTTTTACTGTAGTTCTGCC
1367BE498730_2_D_1241241SBEFORWARD972759.4537.045294.82A/C124ATTGCTAGTTTTACTGTAGTTCTGCCT
1368BE498730_2_D_1331331SBEFORWARD1062758.3437.045291.48T/C133TTTACTGTAGTTCTGCCTCATAGTTCT
1369BE498730_2_D_1491491SBEFORWARD1212859.1939.298390.89T/C149CCTCATAGTTCTATCAGTCCACTTAAAC
1370BE498730_2_D_1491492SBEREVERSE1782762.8340.744287.34T/C149AATAGGAGTGATTGGACATGAACTGAC
1371BE498730_2_D_2292291SBEREVERSE2582763.1440.744388.07A/C229TAATCAGTCAAGAACCGCTCAGTTAAG
1372BE498730_2_D_2312311SBEREVERSE2602762.7740.744389.18G/C231AGTAATCAGTCAAGAACCGCTCAGTTA
1373BE498730_2_D_2822821SBEREVERSE311276233.337393.37G/T282GAACCTTTTCTCAAAGATAATGTGGAA
1374BE498750_1_D_1471471SBEFORWARD1222564.27363167.38G/C147CCTTTCGTTTGGTTGATGATTGTTT
1375BE498750_1_D_1481481SBEFORWARD1232563.73363169.01G/C148CTTTCGTTTGGTTGATGATTGTTTG
1376BE498768_5_A_1231231SBEREVERSE1522756.4125.934386.74T/C123TTCAAGTTTCAGTTGTTTAAGTAGTTT
1377BE498786_3_B_2472471SBEREVERSE2762755.5925.933180.31T/C247ATCCAGTAAAGTGAGTAATAAAAGAAA
1378BE498820_1_A_11111SBEREVERSE382552.8328161.72T/C11GTACTAGTAACAATAACAAAGCACA
1379BE498820_1_A_2632631SBEFORWARD2382564.94406268.92T/C263ACAACTATGCGCAGATGATTGATGA
1380BE498820_1_A_2632632SBEREVERSE2912664.6446.153376.29T/C263GTTCTCAATCTTTTCCAGTCCCTCAG
1381BE498820_1_B_6156151SBEFORWARD5892664.4638.467277.66T/C615ATTATTAATGCAGATACCCGGTTGGA
1382BE498849_7_D_87871SBEFORWARD602764.3240.745283.49T/C87ATCTCAGGGAGTATTAAATCAGCGACA
1383BE498849_7_D_87872SBEREVERSE1162758.1529.636393.2T/C87AATATATACTCCCTCCTTTCCAAATTA
1384BE498849_7_D_7297291SBEFORWARD7032664.9442.317377.89A/T729GATTCAACTTTGTTGACCCAACTGTG
1385BE498878_5_D_4394391SBEFORWARD413266034.623288.54T/C439GCCTAAAAGTATTCAAAGTGTGTCAA
1386BE498878_5_D_4394392SBEREVERSE4682758.7137.046394.88T/C439GTGTGCATTTTCATACTATTAGGACTC
1387BE498892_2_A_1311311SBEREVERSE1602755.125.935281.77A/C131ATGTATAAGAAATAAACATCATCTGTG
1388BE498892_2_A_2082081SBEFORWARD1812761.1229.636395.38T/C208TTTTGCAGTCAAGCTTTTTGTTAATAC
1389BE498892_2_A_2082082SBEREVERSE2372759.837.044295.24T/C208AACTAAGGAGTTCATCCAGTGTGTATT
1390BE498892_2_A_3243241SBEREVERSE3532762.633.336289.3T/C324TCGTTAAGGAAAGCACAAATAAGAGAA
1391BE498892_2_A_4314311SBEFORWARD4042760.3837.046397.6A/T431TAGTTAAGTACCAGGGCAACCATATTA
1392BE498892_2_A_4334331SBEFORWARD4062761.3740.744393.38T/C433GTTAAGTACCAGGGCAACCATATTAAG
1393BE498892_2_A_4784781SBEREVERSE5072760.6237.044395.63T/C478CCAGTATGTATTAACAAAAAGCTCGAC
1394BE498892_2_A_5545541SBEREVERSE5822664.6142.314376.99A/C554TTTACAAACAGGAGCAGGTGTGAAAC
1395BE498892_2_A_5595591SBEREVERSE5882764.3640.746385.66T/C559AATGTCTTTACAAACAGGAGCAGGTGT
1396BE498892_2_A_6286281SBEFORWARD6012763.1440.742285.15A/C628CAGTTTGTTCTCTTCGTGCTATCCTTA
1397BE498892_2_A_6286282SBEREVERSE6562664.438.465378.25A/C628GACCCAAGGTTTAACAAAATGTGCTT
1398BE498892_2_A_6506501SBEFORWARD6232759.5433.337397.99G/T650CCTTACTAAGCACATTTTGTTAAACCT
1399BE498892_2_B_5605601SBEFORWARD5332764.5344.444282.24T/C560GAAGAGCTAAGGAGTTCATCCATTGTG
1400BE498892_2_B_6216211SBEFORWARD5962562.56445275.44T/C621AGTTAGGCAGCTCAACCTCAATGTA
1401BE498892_2_B_6216212SBEREVERSE6502761.3529.634391.23T/C621ATAAGGCAACCATAGATGATGTTTTTT
1402BE498892_2_B_6226221SBEFORWARD5962663.5342.315380.87T/C622AGTTAGGCAGCTCAACCTCAATGTAA
1403BE498892_2_B_6226222SBEREVERSE6512761.3529.634393.46T/C622AATAAGGCAACCATAGATGATGTTTTT
1404BE498985_7_A_42421SBEFORWARD152762.1544.444391.06T/C42CGACTCATCCAACAGAGATACTCACTA
1405BE498985_7_A_6456451SBEFORWARD6192660.5634.628391.65T/C645GTGCAAATATATCTCCAATATGCTGA
1406BE499019_4_D_1201201SBEFORWARD932757.5637.045289.14T/C120AAGAATCAACCTACTTGTGGATACTAC
1407BE499251_2_A_86861SBEFORWARD612563.9443270.17T/C86CATCAGACCTTCATCCCTTTCTTGT
1408BE499251_2_A_1081081SBEREVERSE1362664.442.314373.01G/C108TACATAATTGACAGCAGCAGCAGAGA
1409BE499251_2_A_4984981SBEFORWARD4722660.2638.464390.04T/C498CATAGATCGTCCATAAGAAATCACTG
1410BE499251_2_D_1231231SBEFORWARD972664.1446.156379.66T/C123GTCATGTAGATCATCATCGGACCTTC
1411BE499251_2_D_2562561SBEREVERSE2842664.2146.155378.82G/C256CTCCCATAGATATTCAATCCTCTGCC
1412BE499257_5_D_3333331SBEREVERSE3612661.0438.464184.39T/C333GAGATAAACTTAAACCAGAACGACCA
1413BE499257_5_D_4214211SBEFORWARD3942761.933.338292.64G/T421CACCAAATACCTATTTTTATCCAATGC
1414BE499257_5_D_4214212SBEREVERSE4482564.8484268.11G/T421CTGCAAGAGGGGAATTAGCCATAGT
1415BE499257_5_D_6146141SBEREVERSE6422659.9334.627392.49T/C614TGAATCAGATTAAGCCTATATGCAAC
1416BE499257_5_D_7447441SBEREVERSE7732761.2633.337395.59T/C744AAACAACTTGTATATGATGGGCCTTAT
1417BE499309_3_B_3323321SBEFORWARD3062661.73504385.64T/C332GACATCTACAGCTACAACCCAGACTC
1418BE499309_3_D_22221SBEREVERSE512757.9329.634391.3G/T22ATAGTCCAATTCAGGTTAAGCATATAA
1419BE499309_3_D_2832831SBEREVERSE3112663.7142.315380.32T/C283ACACAAGGTTTCTGTGGATAAGATCG
1420BE499340_4_B_1831831SBEFORWARD1562758.9233.338295.1G/T183TTAATTAAGCTAGGCTCTGACTTTTCT
1421BE499340_4_B_2082081SBEREVERSE2372759.1137.048397.34G/C208ACATATCCACTTTAGTGATCTGACAAG
1422BE499362_2_B_2572571SBEFORWARD2302761.1333.332189.53T/C257TATGCTTGGTGTATCTTTGTATGGTTT
1423BE499362_2_B_3373371SBEREVERSE3662757.5637.046188.1G/T337CTATGTGATATCGAAAGGTATAGAGGT
1424BE499362_2_D_54541SBEFORWARD272763.5740.746286.36G/T54ACGACACCGAAGGTCTTCTTTTACTTA
1425BE499362_2_D_54542SBEREVERSE832760.7429.633394.66G/T54TAAATAAACTTGAAAAGCGTGAACAGT
1426BE499362_2_D_1611611SBEREVERSE1882563.46404272.12T/C161GTTTGGAGCAGATACGCATTGATAA
1427BE499362_2_D_2672671SBEFORWARD2402764.840.744281.43A/T267GAAACACTTAGGCAGATGTCCTTGAAA
1428BE499478_2_B_3853851SBEFORWARD3582759.4840.744395.95T/C385TATACTACCCACCAGTTCTTGACTGTA
1429BE499478_2_B_3853852SBEREVERSE4142764.8340.743280.73T/C385ATACAAACAATAACCAGTGTGGCGAGT
1430BE499478_2_B_4214211SBEFORWARD3932859.732.143287.64T/C421CACACTGGTTATTGTTTGTATTATCTCA
1431BE499546_4_B_49491SBEFORWARD232663.6142.317381.88T/C49GTGGTTGGATTCCATATTGACGTATC
1432BE499546_4_B_49492SBEREVERSE782761.0744.445293.25T/C49AGTTAGGACAGGTACAGTAAGAGGGAA
1433BE499546_4_D_2212211SBEFORWARD1942757.6129.634288.65A/T221TTTTTGTATTTCTAGGCTCAACTAACT
1434BE499546_4_D_2212212SBEREVERSE2502762.737.044186.06A/T221AAACTACCAGACATGCAACGAAATAAC
1435BE499546_4_D_6706701SBEFORWARD6442660.3538.464389.77T/C670TGATAACTGCATCATTGTACTGTCAC
1436BE499546_4_D_6706702SBEREVERSE6992761.7240.745189.63T/C670CAGAAAGAAATCTGTAACATAGGAGGG
1437BE499599_5_D_6116111SBEREVERSE6382564.6444268.7G/C611TAAGCAGCAGCCAAGCATCTAAACT
1438BE499599_5_D_8378371SBEFORWARD8112664.5446.154275.55T/C837ATATCAGAAGTGGGGTATGGCAAGTC
1439BE499599_5_D_8378372SBEREVERSE8662763.9640.744385.62T/C837GATGCTAGACGTGCCTAATGAAAGATT
1440BE499652_7_A_2862861SBEFORWARD2592758.9737.044394.4T/C286AGACCAAGAAACTACCTAAGAAATCTG
1441BE499652_7_A_2862862SBEREVERSE3152757.633.334390.31T/C286ACACGCAGAGAGTATTAAAAGTTAGTT
1442BE499652_7_A_3023021SBEFORWARD2752757.5225.934390.05A/T302TAAGAAATCTGCCAACTAACTTTTAAT
1443BE499652_7_A_3023022SBEREVERSE3312758.8629.637192.62A/T302AATTGAATTATTAAGTACACGCAGAGA
1444BE499652_7_A_3913911SBEREVERSE4202764.3337.042281.59T/C391ACAAAGAGCCCAATAGTCAAAAAGGTT
1445BE499711_6_B_96961SBEFORWARD692761.3437.046191.39A/T96CCACAGCAGATTATAAATAAGCACAAC
1446BE499711_6_B_6946941SBEREVERSE7232762.1233.338393.65T/C694GTTTTGGAAAACATCCAACAGATTTAC
1447BE499711_6_D_9209201SBEFORWARD8932760.3333.334294.84T/C920GGGATTTTATCACTTTCCTTAATCTGT
1448BE499822_4_A_2212211SBEFORWARD1962562.01404174.79T/C221CATCCTTACGCTTATTGACTGCTTT
1449BE499835_5_A_3643641SBEREVERSE3932763.7140.746184.29A/T364TGACAGGGTCAGTAATGATAAGCAAAG
1450BE499835_5_A_6366361SBEFORWARD6102663.1246.155280.43T/C636GACCCGTATCTTCTTTCACGAGTCTA
1451BE499835_5_A_6746741SBEFORWARD6472755.5925.936385.51G/T674TTCTATTTCTAAATGTTTCTACCAGTT
1452BE499835_5_B_1451451SBEREVERSE1742761.8537.045290.91T/C145ACATCTTGTTTAACCGAAAGTGGTATC
1453BE499835_5_B_2932931SBEREVERSE3222759.2525.934393.03T/C293ATTACATAAAAAATGGTATCTGTGCAA
1454BE499948_4_D_5825821SBEFORWARD5572562.97364375.27T/C582CATGTTTCATTTACGTTTCCACACA
1455BE500122_7_A_7587581SBEREVERSE7872762.3333.334390.5A/T758AAATTACTCGTCGTGGTTTTAGTTCAA
1456BE500122_7_A_7917911SBEFORWARD7642764.0237.044283.77T/C791ACTAAAACCACGACGAGTAATTTGGAA
1457BE500122_7_A_7917912SBEREVERSE8202760.940.746192.72T/C791ACAATGTTCACTGTAATGTACTCCCTC
1458BE500122_7_A_8538531SBEREVERSE8822759.8825.938194.08T/C853TCATTAAAAAATTGTTCTAAACTGGCT
1459BE500206_2_A_2072071SBEFORWARD1802764.7944.444383.14T/C207CTACCAAGCACAGGTACTCCTTTTGAA
1460BE500206_2_A_2682681SBEFORWARD2412763.5740.744183.47T/C268AAGTTCCAGAGATATACAAAGGAGCCA
1461BE500206_2_A_3073071SBEREVERSE3362758.5933.335393.89G/T307TTAATAATGGTAGTTGGATCTCACAGT
1462BE500206_2_B_45451SBEFORWARD182764.3348.157386.38A/C45CTGATAGGCTACCAAGCACAGGTATTC
1463BE500206_2_B_67671SBEFORWARD402762.3737.045391.01A/C67TATTCCTCTTGAACTCTCAAATTCTGC
1464BE500206_2_B_79791SBEREVERSE1082758.2337.044290.53G/C79CTTTGTATATCTCTGGAACTTAACTCG
1465BE500206_2_B_1191191SBEFORWARD922761.8440.744188.66T/C119CCAGAGATATACAAAGGAGCAAGAAAC
1466BE500206_2_B_1691691SBEFORWARD1422760.7437.045294.24T/C169AATAAATCAACTGTGACACCCATCTAC
1467BE500206_2_B_2242241SBEFORWARD1972760.5840.744294.08T/C224CTAGCAATTCAGTTAGTGGTTGAGAGT
1468BE500206_2_B_2242242SBEREVERSE2532763.5837.048389.27T/C224GAGTTTCCTATTAATAAAGGGGCCAAA
1469BE500206_2_B_2382381SBEREVERSE2672763.8444.445386.6A/T238GATGGACAGGACAGGAGTTTCCTATTA
1470BE500206_2_B_3013011SBEREVERSE3282563.99484372.21T/C301CTCTTTCCTAGAGTGTGGCATGTGA
1471BE500206_2_B_3143141SBEREVERSE3432757.2533.337391.13A/C314GTGAAGAATAACTTTCTCTTTCCTAGA
1472BE500206_2_B_3283281SBEREVERSE3552564.59448271.22T/C328CGGCATATGCTCGTGAAGAATAACT
1473BE500206_2_B_4264261SBEFORWARD3992752.6325.936376.65T/C426TCTGTCTCTAAGTTAACAATTCTAATA
1474BE500206_2_B_4354351SBEREVERSE4642763.4737.046286.68A/T435ATATCTCATGCCTAAATTTCCATGTCC
1475BE500206_2_B_4364361SBEREVERSE4652762.9437.046389.93A/T436CATATCTCATGCCTAAATTTCCATGTC
1476BE500206_2_B_4564561SBEFORWARD4312563.52368376.09G/T456TTACATGGACATGGAAATTTAGGCA
1477BE500206_2_B_4564562SBEREVERSE4832562.59445377.02G/T456ACATCTTCCTCCGAGAACCATATCT
1478BE500206_2_B_4694691SBEFORWARD4422764.2937.046385.89A/T469TGGAAATTTAGGCATGAGATATGGTTC
1479BE500291_5_A_33331SBEFORWARD82564.33484371.18T/C33TCTCTCTGTCTCTCTCATGCCAATG
1480BE500291_5_A_33332SBEREVERSE622764.2948.152281.7T/C33GAGAGAAGAGAATGAGACCAAGACAGC
1481BE500291_5_A_42421SBEREVERSE712763.5244.444285.27T/C42TCACATCAGGAGAGAAGAGAATGAGAC
1482BE500311_4_A_5415411SBEFORWARD5152661.7738.464283.86T/C541ACAAGATCAAGCAGAGGAAACAACTA
1483BE500311_4_B_77771SBEFORWARD502762.2633.335184.68A/T77GTGAGCTGTGAGCTGTTATTTTTTTTT
1484BE500311_4_B_77772SBEREVERSE1062759.0725.935293.67A/T77CTATTAGCAAAATCACAATAACCAAAA
1485BE500311_4_B_79791SBEREVERSE1082759.4525.935294.81T/C79TTCTATTAGCAAAATCACAATAACCAA
1486BE500311_4_B_4154151SBEREVERSE4432658.5134.628388.87T/C415CATAACAACCATTGTGTTCTGAGTAT
1487BE500311_4_D_2852851SBEREVERSE3142763.2337.046389.06A/T285CAACCACGTGTATTCATATTCAAGGAT
1488BE500311_4_D_4814811SBEREVERSE5092662.9746.154280.27A/T481CTTTCTAGCGTAGTTGTTTCCTCTGC
1489BE500317_4_B_24241SBEREVERSE532761.2537.043291.45G/T24TGACCACACACATAGTTCAATCAATAC
1490BE500317_4_B_2432431SBEFORWARD2162757.4729.632185.32G/C243TTTTCATCTCTACTTTGTCTTATCCTT
1491BE500317_4_D_1821821SBEFORWARD1552764.6940.744281.77T/C182CAGTCCTATCTTTGAGGAAATGGAACA
1492BE500317_4_D_1821822SBEREVERSE2102662.534.624179.99T/C182GCAGCACCAATAGAAAATATCAAACA
1493BE500317_4_D_4284281SBEFORWARD4012756.933.334388.2G/T428GGTTATTGATACTTCCTCTGTAAACTT
1494BE500317_4_D_4284282SBEREVERSE4572755.5433.337386G/T428CTACTTTAGTGATCTAAACGCTCTTAT
1495BE500453_6_A_15151SBEREVERSE422563.01525274.1G/C15GAGATGGAATAGCAGGGCTAGAGAG
1496BE500453_6_A_2492491SBEFORWARD2242563.59486374.65T/C249CGCTTGTATAGACATCTCAAGCTGC
1497BE500453_6_A_3683681SBEREVERSE3972754.8833.335281.09A/C368TGTTTAGAAAGTACAGTAACAGGTAAG
1498BE500453_6_D_1291291SBEFORWARD1022759.6137.044193T/C129ATCTGTTCTACTCTCTGTTCAGCTTTT
1499BE500453_6_D_1291292SBEREVERSE1582764.0544.444283.69T/C129GATATACTAAGAAACCCGGACGAAACC
1500BE500480_5_B_3443441SBEREVERSE3732763.8233.334386.05T/C344TTGCATCAAATCCTCCCATATAAGAAT
1501BE500510_3_B_5505501SBEREVERSE5782656.8223.084381.3T/C550TTTCTTTCCTTGAACCATAAATATAA
1502BE500615_7_A_1071071SBEREVERSE1352661.9838.463384.28A/T107CAAAGAAGAGCCATACATCACAACTT
1503BE500615_7_A_1971971SBEFORWARD1702754.6925.938282.41T/C197TAAATTTACCAATCACATTATAGTAGC
1504BE500615_7_D_1121121SBEREVERSE1402661.8542.316284.86T/C112CACCATAGCATATGAAGTCACAACAC
1505BE500615_7_D_1561561SBEREVERSE1842661.2342.315286.09G/C156ACTACCACAGAAGGTTCAGAAAGATG
1506BE500615_7_D_4364361SBEFORWARD4112556.5328172.84A/C436AATATATTTTACTGTTGGTCGTGTG
1507BE500615_7_D_4364362SBEREVERSE4642664.6438.464275.24A/C436TTTGCCTCCCAAGACAAGAAAAATAG
1508BE500768_6_D_6376371SBEREVERSE6642563.53442270.66T/C637AGCAAACCAAGACAGAAAGAAGAGC
1509BE500894_5_B_60601SBEREVERSE912955.5420.694269.13T/C60GAATTTGGTAATAAAAGTAAATAAGAAAG
1510BE500894_5_B_2362361SBEFORWARD2092764.0140.744385.46T/C236TTTAAGATGGTGGAAGAGGAAACTGAG
1511BE500894_5_B_2362362SBEREVERSE2652763.6137.045285.63T/C236TCATTCAATAGTACCTGAGTTTTTGCG
1512BE500894_5_B_3193191SBEREVERSE3482763.2237.045388.48T/C319AACTAAATGGAATTTGCACCCTACACT
1513BE517627_2_A_1631631SBEREVERSE1922762.2529.634289.09T/C163AATCAGCGTCCAAAAACTGAATAAATA
1514BE517627_2_A_2352351SBEREVERSE2652859.6632.146289.4G/C235GCTTTAAACTGATACAAGAACAACAACT
1515BE517627_2_A_3513511SBEFORWARD3242761.8837.048394.36T/C351GTTTTACTATGCGCATCTGATTGTCTA
1516BE517627_2_A_3513512SBEREVERSE3782564.52445269.56T/C351AGGAACTATTGAGTTTGGAGCAGCA
1517BE517627_2_B_2212211SBEREVERSE2502763.6829.635285.42T/C221TTTGAAAACAAGAACAAATACAACCCA
1518BE517627_2_B_3343341SBEFORWARD3072763.5133.334386.97T/C334GTGCCGATATTGTTTCATTTGATTATG
1519BE517627_2_B_4734731SBEFORWARD4482562.73368378.48G/T473AGCATGTTCTGAAGAATCATTTTGG
1520BE517627_2_B_4734732SBEREVERSE5022762.2940.744288.95G/T473GACCTCAACAACCTAGCTCAAAGATTA
1521BE517627_2_D_2612611SBEFORWARD2352661.44506387.77T/C261GTTATGTACCTACTACCACGCAGGAG
1522BE517627_2_D_2612612SBEREVERSE2892659.8138.468189.43T/C261GCACAGCTTTAAACTGATACAAGAAC
1523BE517671_4_A_2842841SBEFORWARD2572760.7840.745395.78G/C284GCTTACAGTGACAATGAGGTAGTTTTC
1524BE517671_4_A_2842842SBEREVERSE3112563.08448377.44G/C284AAGAATTCTGTCATGGAGATCCCTC
1525BE517709_3_B_4764761SBEREVERSE5052753.5922.224276.6G/T476AATACAGTTAAATAAAGAGAAACACAT
1526BE517709_3_B_6006001SBEFORWARD5732764.9937.046282.11T/C600ATTTGTGCTGATATTTCTCAGGTTGGA
1527BE517711_5_A_5555551SBEREVERSE5842756.5629.634387.19T/C555AATTAAGAAACTAATCTACCAACAGGT
1528BE517711_5_A_5615611SBEREVERSE5912858.4732.146184.17G/C561CACACTCAATTAAGAAACTAATCTACCA
1529BE517729_1_B_67671SBEREVERSE952662.8246.154382.38T/C67AGTGACCTGTAAACCATCAGGGATAG
1530BE517729_1_B_2042041SBEFORWARD1772760.8437.045395.59T/C204CAGATGGTATGTTGTGCTATGATAATG
1531BE517729_1_B_2042042SBEREVERSE2332760.6129.634294.01T/C204TGCTAACATTTAACCAGTTTTCTTCAT
1532BE517729_1_B_2302301SBEREVERSE2592764.0133.336386.72G/T230TAACTGCCTGTAATTTTTCAATTGCCT
1533BE517729_1_D_1371371SBEFORWARD1102762.9540.746389.91A/T137TGCTCTTAGGGACATAATGAACAGAAC
1534BE517729_1_D_1751751SBEREVERSE2042758.3225.937394.33T/C175TGTGCTATGATAATGATATGAAGAAAA
1535BE517729_1_D_3783781SBEFORWARD3512764.2444.445283.75T/C378TCCTTTTGCTACTAGATTCAGGCTCAC
1536BE517729_1_D_3783782SBEREVERSE4052562.4447378.85T/C378GTAATTTACTGTCTGCCGCAGTTTC
1537BE517732_3_B_2442441SBEREVERSE2722663.1438.466280.99G/T244CAGTTCTTGGCCATAAATAACTTTGC
1538BE517732_3_B_4534531SBEREVERSE4822759.1437.043292.62T/C453CTGAATCTGTTAGGTTATGGACTGTTA
1539BE517780_3_B_1401401SBEREVERSE1692756.1233.333385.22T/C140GCTTGACCTCTAATACTTTGTTACTTA
1540BE517805_1_B_46461SBEFORWARD212557.82367277.82T/C46ACTTATGGAGCATGAAGTTATATGG
1541BE517805_1_B_46462SBEREVERSE752757.2722.224185.98T/C46TATTTTCTTCTATATGATTTTCCGTTT
1542BE517805_1_B_51511SBEFORWARD242762.8533.334287.29T/C51TATGGAGCATGAAGTTATATGGGAAAA
1543BE517805_1_B_51512SBEREVERSE802755.0122.224280.88T/C51GCTTTTATTTTCTTCTATATGATTTTC
1544BE517805_1_B_73731SBEFORWARD462759.4225.934192.44T/C73GAAAACGGAAAATCATATAGAAGAAAA
1545BE517805_1_B_1031031SBEFORWARD762762.5833.336391.02T/C103AAGCTTAAGACAAATGTTCTCATTGGA
1546BE517805_1_B_3323321SBEREVERSE3612764.440.744282.64G/T332TATTATTCGATTGTGCGTGTAGCTGTC
1547BE517805_1_B_3363361SBEREVERSE3652761.337.048294.43T/C336CTAATATTATTCGATTGTGCGTGTAGC
1548BE517805_1_B_3413411SBEREVERSE3702764.9237.048385.24T/C341CATGCCTAATATTATTCGATTGTGCGT
1549BE517805_1_B_3453451SBEFORWARD3192654.6430.778275.58T/C345AGATTATATTCTTTTGACAGCTACAC
1550BE517805_1_B_3483481SBEFORWARD3212761.4533.334291.5T/C348ATTATATTCTTTTGACAGCTACACGCA
1551BE517805_1_B_4484481SBEFORWARD4212757.5825.937290.46T/C448TTTGTGAATACAAAATACCAACTAGAA
1552BE517805_1_B_4484482SBEREVERSE4772761.437.044189.96T/C448GATAATGACTTGACTTGAACAAACTGG
1553BE517805_1_B_4504501SBEFORWARD4232757.6329.634288.73G/C450TGTGAATACAAAATACCAACTAGAAGA
1554BE517805_1_B_4504502SBEREVERSE4792759.933.334295.53G/C450AGGATAATGACTTGACTTGAACAAACT
1555BE517805_1_B_4904901SBEREVERSE5192756.8322.227288.21T/C490ATCCTAAATTTTATTCTGATTTTCAAC
1556BE517805_1_B_4924921SBEREVERSE5232959.5624.147384.73G/T492GGTAATCCTAAATTTTATTCTGATTTTCA
1557BE517805_1_B_5065061SBEFORWARD4792760.1425.936398.34T/C506TCAATATTATGTCGTTGAAAATCAGAA
1558BE517805_1_B_5645641SBEREVERSE5932758.6337.046292.98A/T564GGTGACAGAATATACTTACGAACAAAC
1559BE517805_1_B_5745741SBEFORWARD5472755.425.937385.57T/C574TAACATGTAGTTAAACTTTGTTTGTTC
1560BE517805_1_B_6126121SBEFORWARD5872563.36484272.41T/C612GTCACCTTTTCTGGTTGACACACTC
1561BE517805_1_D_2312311SBEFORWARD2042761.937.044188.48T/C231TTATATTCTTTTGACAGCTACACGCAC
1562BE517805_1_D_3763761SBEFORWARD3502656.8830.776281.04T/C376GTCATTATCCTTCAATATTATGTCGT
1563BE517805_1_D_3763762SBEREVERSE4062859.57257391.42T/C376CGGTAATCCTAAATTTTATTCTGATTTT
1564BE517805_1_D_5685681SBEREVERSE5962659.7534.625390.71T/C568CTCAACTAACACATTATATGCGGATT
1565BE517831_2_B_71711SBEFORWARD442757.5425.934390.11G/C71TAAAACAGTATCCATTTATCTGAAACA
1566BE517858_6_B_1591591SBEFORWARD1322764.6837.046283.03T/C159CAGCTGATGATAAAATTTGTGGCTCTT
1567BE517877_2_A_43431SBEFORWARD142956.5631.035374.47T/C43GGTATTACACTATTTTCATTGTACTTCTC
1568BE517877_2_A_82821SBEFORWARD552752.5929.635274.21T/C82TCTCTCTTAAACTATAACTCTTACCTT
1569BE517877_2_A_97971SBEFORWARD702761.7333.332185.13T/C97AACTCTTACCTTTTTTTCTTTTGCCTC
1570BE517914_3_A_5465461SBEREVERSE5752757.9629.634391.38T/C546AGCTAATAATACCAAATGAACAACAGT
1571BE517914_3_B_47471SBEREVERSE762758.7422.223288.85A/T47ACTCAAATGTCAATACAAAAAAAGAAA
1572BE517914_3_B_48481SBEREVERSE772758.7422.223187.18A/T48AACTCAAATGTCAATACAAAAAAAGAA
1573BE517914_3_B_3403401SBEREVERSE3672560.33406282.75T/C340GTTTGTTAGACACAACTTCCAAAGG
1574BE517914_3_B_3413411SBEFORWARD3152657.8138.468386.75T/C341TTATAGCCCTCATTAGGCTACTTATC
1575BE517914_3_B_3413412SBEREVERSE3682561.26406381.65T/C341CGTTTGTTAGACACAACTTCCAAAG
1576BE517914_3_B_4084081SBEREVERSE4372757.8829.634391.13A/T408ACCATTTTGAGATAACTTTACACAGAT
1577BE517914_3_D_1841841SBEFORWARD1592564.09404270.23T/C184ACATTGAGCAACATGCCTCTGATAA
1578BE517914_3_D_2892891SBEFORWARD2622759.5633.332293.27T/C289TATGTTATCCGCTGTTCTTATTGTCTA
1579BE517914_3_D_6336331SBEREVERSE6602561.12404380.81T/C633CATTTGTTAGACACAACTTCCAAGG
1580BE517914_3_D_7957951SBEREVERSE8242760.233.334396.89T/C795AGCTAATAATACCAAATGAACAACAGC
1581BE517946_2_D_1481481SBEFORWARD1212760.9437.047396.56T/C148GAGGTCACCTATACTTTTCAAATCACA
1582BE517946_2_D_4104101SBEFORWARD3832763.9340.744182.37G/C410GACTCTATGGAATGGTCTGGAAAGAAA
1583BE518003_3_B_42421SBEFORWARD152762.7637.043286.94G/C42GATAGATAAATGGCAGAGGAAAACACA
1584BE518003_3_B_3323321SBEREVERSE3612757.3429.635390.14T/C332GACACAAATTATTCACTATAAAGCAGA
1585BE518142_6_D_1221221SBEREVERSE1512764.7340.744281.63G/C122ATTCGTTCCAACACACATAGAAGAAGC
1586BE518255_4_A_1241241SBEFORWARD972763.7537.045285.2T/C124ATTAGGAAATCATCATGGCTGAAAGTC
1587BE518255_4_A_1241242SBEREVERSE1532761.6740.745393.12T/C124CACCACCTATGTAAATCACAGACAGAT
1588BE518255_4_B_2112111SBEFORWARD1852660.2626.926391.29A/T211TCAAAATGCTTTGAAGGTATGTAAAA
1589BE518255_4_B_2112112SBEREVERSE2392664.9538.468175.16A/T211CATGGAACCAATTGGAGAAAAAGAAG
1590BE518255_4_D_1201201SBEREVERSE1492759.9233.333294.97T/C120CCAACAACTCAACAACAGTCTAAAATA
1591BE518357_7_B_4244241SBEFORWARD3972763.7744.443283.91T/C424AGTTTACCATAACGAAGGGTGCTGTAG
1592BE518357_7_B_4244242SBEREVERSE4532759.1129.634293.16T/C424TATGGTGAAAGAGAATAAAATGTTGAG
1593BE518358_1_A_6186181SBEREVERSE6472759.3133.334395.42T/C618TCCTAAGTTTAAGCCTGACAAAATACT
1594BE518358_1_B_6816811SBEFORWARD6542759.4925.934294.32T/C681ATTAAACTCCTTTTTGGCTATTTTTCT
1595BE518358_1_D_4374371SBEFORWARD4092862.0321.436383.12T/C437CATGATTAAATTGAAAAAAAATGCTTTG
1596BE518358_1_D_4374372SBEREVERSE4662764.540.744282.34T/C437TAGATGCTTGATCCCCACTGTATTTTC
1597BE518379_6_A_2312311SBEFORWARD2042764.2437.044283.1T/C231ATGATTTAGGCACGAATGTTCAGACTT
1598BE518379_6_D_4544541SBEFORWARD4292564.59483268.1A/C454TAGGCACAGAGTGTTTAGGGGTTTG
1599BE518379_6_D_5035031SBEFORWARD4762759.8433.336194.92G/T503GTGCTACATGTTGTTTTATCTGTGTTT
1600BE518379_6_D_5035032SBEREVERSE5302563.68444271.47G/T503CAGTTAATTTCTAGCCCAGTCCCAA
1601BE518393_1_A_1151151SBEFORWARD902563.5485374.28T/C115GAGGTCCTTCATCAATATCTGGAGC
1602BE518393_1_D_1261261SBEREVERSE1542664.3246.155378.49A/T126GTGAATCCTAAGGGTGAGATGAAAGG
1603BE518393_1_D_8338331SBEREVERSE8622759.6625.935397.1T/C833ATGTTAAAGTCTGCCATTATTTGATTT
1604BE518393_1_D_101810181SBEREVERSE10472761.240.744292.23T/C1018GGTATCGACTCTCTTGATTTCTTTAGC
1605BE518403_1_B_7797791SBEREVERSE8072661.4834.622283.46G/C779CCTTTAGTTTTCTTCTTTTGATGCCT
1606BE518435_1_A_91911SBEREVERSE1182562.19407176.15T/C91TTCAAGTCCAGAGGAAATGAAAGAG
1607BE518435_1_A_3383381SBEREVERSE3672762.3825.935390.97T/C338TTTCAACTGATTTTCATTGTGATTTTG
1608BE518436_7_A_1231231SBEFORWARD962761.4437.044291.53T/C123ACTACTCCTTACTTTTGAATTTGACGC
1609BE518436_7_B_78781SBEREVERSE1072754.422.228383.21G/T78GGTATAAATATTTCTCAATTATCATCA
1610BE518436_7_B_6716711SBEFORWARD6442764.9837.045281.52T/C671TGTCATTATACAACATGCAAATGGCTC
1611BE518436_7_D_2602601SBEREVERSE2882664.5446.155276.18G/T260AGGCCCGTCTATTTCAAAGGAGTAGT
1612BE518436_7_D_4254251SBEFORWARD4002564.39444167.68T/C425TTGTCGTACTTCCTATTGCCCATTC
1613BE518436_7_D_4584581SBEREVERSE4872763.9937.044385.54T/C458TTACAAAGATGTGGCAAGTAATCCAGA
1614BE518436_7_D_4704701SBEFORWARD4422855.4428.576378.41T/C470CACTAGTTCATTTATTATTCTGGATTAC
1615BE518440_2_A_1871871SBEFORWARD1602762.1529.634187.72G/T187AAACGGAGAACACGATAAATATGAAAA
1616BE518440_2_B_2232231SBEFORWARD1962759.8437.048399.52T/C223ATGTATATACTCCCTCCGTTCCTAAAT
1617BE518440_2_D_30301SBEFORWARD42664.8842.316174.1T/C30TTCTTTGGGTCAGTACTTTCGCTTTC
1618BE518440_2_D_3173171SBEFORWARD2902764.737.045384.02T/C317TGCTACTGGCATGAATGTATGAAATGT
1619BE518440_2_D_3603601SBEFORWARD3332764.0337.044182.09A/T360GAACATAGAAGCCAATCCAATTTTCAC
1620BE518446_3_A_1321321SBEREVERSE1612754.7722.228282.63A/T132TTATATATATGAATTATCAAGGTTCCA
1621BE518446_3_A_1371371SBEFORWARD1112661.0138.464387.8T/C137GTTTACTTGACTGTATGCACATTTGG
1622BE585702_6_B_3913911SBEREVERSE4202762.0337.045392.04T/C391AGAATCTACAGTTGCCAAATCCTAATG
1623BE585724_5_D_2162161SBEFORWARD1892761.5137.044189.63T/C216GATATTTTCCTTCTTCCTTCGTACCTT
1624BE585724_5_D_2392391SBEREVERSE2682759.9629.634295.71A/T239TTAACCATACCTGTCAACATCAAAATA
1625BE585724_5_D_2952951SBEFORWARD2692661.0342.314286.08T/C295GAGCTGACTGGTGGGTATAAGATAAA
1626BE585724_5_D_4694691SBEREVERSE4962562.27407379.24T/C469GTCCGAAAAGGCTTGTCTTAGATTT
1627BE585744_7_A_771SBEREVERSE342564.78524268.15T/C7GTAGGAGATGCGAGTACCGTGTGAT
1628BE585744_7_A_5695691SBEFORWARD5432654.4926.926375.54T/C569TTCTAGAGAGAATTCCTTATTTAACA
1629BE585744_7_A_141714171SBEFORWARD13902763.1440.743285.78T/C1417CTTGTCTCTGATGCTTGTTGAATAGGT
1630BE585744_7_D_3783781SBEFORWARD3512756.9225.934286.61T/C378TCTGATATGTAAAAGAAAAACACAACT
1631BE585744_7_D_3783782SBEREVERSE4072763.3237.044285.87T/C378TCCTGGCAAGTAAGTTCAGACAAATAA
1632BE585773_6_D_1881881SBEFORWARD1632564.62443268A/C188GCAAGCACACAAACACTCTTACCAA
1633BE585773_6_D_1881882SBEREVERSE2172763.0337.043387.79A/C188ACTTGAGGCGATTATTAGTTTTTCCAG
1634BE585780_1_A_2572571SBEFORWARD2312664.734.626375.29T/C257CTTTAGGAAGTTGCAAGCGAAAAAAA
1635BE585780_1_A_4654651SBEFORWARD4402564.58403369.79T/C465CGTGCTGTTTTGGCATTCTTCTAAT
1636BE585780_1_A_4654652SBEREVERSE4952861.5821.435280.05T/C465TGAGTTTTTTTTGTTGAACTTGTTTTTT
1637BE585781_1_D_1331331SBEFORWARD1062758.6729.637395.39T/C133CAGTGTGATGTTACATTCTTATTTCAA
1638BE585781_1_D_1331332SBEREVERSE1602563.44403373.22T/C133GATTCTATTGTCCATTTGCTCCACA
1639BE585781_1_D_1491491SBEFORWARD1232663.9738.464378.92T/C149CTTATTTCAATCTGTGGAGCAAATGG
1640BE585781_1_D_2172171SBEFORWARD1922564.39486372.24T/C217CGAGGCTTCGGTTAGGAATAAACTC
1641BE585797_3_D_55551SBEFORWARD282757.7940.745391.48T/C55AAAGTCTACTCTGCTTGAGACTACTGT
1642BE586072_7_D_2002001SBEFORWARD1722855.72258278.82A/T200CAGTTACATATATTTACCATTTTCTGTT
1643BE586072_7_D_2002002SBEREVERSE2292762.7837.045288.11A/T200ACAGGATAGCAAATGATTGATAACAGC
1644BE586072_7_D_2022021SBEFORWARD1742853.1821.438372.89G/T202GTTACATATATTTACCATTTTCTGTTAT
1645BE586072_7_D_2192191SBEREVERSE2472662.7246.157282.87T/C219CTGTAACAGGACAGGATCACAGGATA
1646BE586140_1_A_77771SBEFORWARD522557.8288278.41T/C77TTTATAAATTTGTTAACCTCCATCG
1647BE586140_1_A_77772SBEREVERSE1062760.8833.334293.2T/C77AAGAACATTTCAGGCCATTTAGAGTAT
1648BE586140_1_B_1971971SBEFORWARD1702764.540.744282.32T/C197CTCTCACGCCTAACAAAACATATCCAT
1649BE586140_1_B_1971972SBEREVERSE2262763.1737.045185.27T/C197CATGGGAGTTCTTATTTAATCTTTCGG
1650BE586140_1_B_2272271SBEFORWARD2002761.1533.335394.68T/C227CGAAAGATTAAATAAGAACTCCCATGT
1651BE586140_1_B_2582581SBEFORWARD2322664.6838.466378.05T/C258GATACATGAACGTTTCAAGCCATTTG
1652BE586140_1_B_2672671SBEREVERSE2962762.5637.045390.43T/C267GTATTTGATAAACTTTGGTCACCTCCA
1653BE586140_1_D_2642641SBEFORWARD2392564.91404267.78T/C264ATTTGGAGTATTGCGATGAGGTGAA
1654BE586141_6_B_1001001SBEFORWARD732763.7337.046184.22T/C100TTCTATTTTCAGCTTAATCGACATCCC
1655BE586141_6_B_1001002SBEREVERSE1292754.9225.934178.92T/C100AAATATAAGTAAACACAAGTACACCAA
1656BE586141_6_B_1061061SBEREVERSE1352756.6225.934283.47T/C106GGCAAAAAATATAAGTAAACACAAGTA
1657BE590469_7_D_72721SBEFORWARD472556.64368376.58T/C72TAGTAAAACAGATATGTTGACTGGG
1658BE590476_7_A_53531SBEREVERSE822762.0637.045391.93A/T53TATGCACCATTTCTACATAGCCTGTAA
1659BE590476_7_D_4624621SBEFORWARD4352764.1444.443181.11T/C462TGGGTCTTCTCATCTCTTCCATCTATC
1660BE590476_7_D_4624622SBEREVERSE4892564.16522167.1T/C462ACTTCTCATCCTCCTCCCTACCATC
1661BE590476_7_D_5165161SBEFORWARD4882858.0532.145283.94T/C516TGTAGTTACTCTATGGTGAATTTTGTCT
1662BE590553_7_A_1901901SBEFORWARD1652564.51445371.25G/C190CAGTCATTTGCTTGGGTTATCCACT
1663BE590553_7_A_1901902SBEREVERSE2192761.5344.444392.9G/C190AGTACACACAGTAAAGTGGGGATACCT
1664BE590553_7_A_2812811SBEFORWARD2542763.9137.044385.78G/T281GAATTGTTGTGCCTGTGTTATTCAAAG
1665BE590553_7_A_2812812SBEREVERSE3102763.2437.044286.12G/T281AATCCATTTCGGTGTGTGTTATAGTTG
1666BE590553_7_A_3743741SBEFORWARD3482660.2934.626391.2T/C374CATTTATGCACCTATATGGTTGTTGT
1667BE590553_7_A_5575571SBEREVERSE5862760.844.444293.43T/C557CATCAGCTTCAGTAGTATCTCGTCTCT
1668BE590553_7_A_6456451SBEREVERSE6732664.7534.626377.83T/C645ATGATGCTTTCCAAACAATCCCTAAA
1669BE590553_7_A_6686681SBEFORWARD6412764.0233.338387.94T/C668GAAAATTTTAGGGATTGTTTGGAAAGC
1670BE590553_7_B_1651651SBEFORWARD1382764.140.745284.17T/C165CTGGCCTATCTCCTTATTGAATTGTTG
1671BE590553_7_B_1651652SBEREVERSE1942758.4233.335291.71T/C165ATAGTATTGAACTTTGAAGAACACAGG
1672BE590553_7_B_2912911SBEFORWARD2652660.9838.468288.73T/C291TACAGATCTGCATGCTATTGTTTCTC
1673BE590553_7_B_4264261SBEFORWARD3992764.3833.334181.04T/C426CTTTTGTTTTGCATCTTTGCTTTCTTC
1674BE590553_7_B_5095091SBEREVERSE5382756.5122.225285.98T/C509TTTATCAGAAAACAAAGAAAGAAACTA
1675BE590582_7_B_2292291SBEREVERSE2582759.7422.228295.35G/C229ATAGCATGCAATCAAGAAAAAATAAAT
1676BE590582_7_B_2952951SBEFORWARD2682761.2737.046394.93A/C295TTTTAAGCTCAAGTAGAGATGCTCAGA
1677BE590582_7_B_2952952SBEREVERSE3242761.2325.937294.03A/C295AACACTGTTAAAATCAATTCGTGAAAA
1678BE590582_7_B_3013011SBEREVERSE3302759.929.637399.06A/C301TACAGAAACACTGTTAAAATCAATTCG
1679BE590582_7_B_3353351SBEREVERSE3642764.1640.748387.51G/C335ACCAGATCCTGGTACACAAAACAGATT
1680BE590634_1_A_1201201SBEFORWARD952555.58286372.16G/T120CTTCTTTCCAATGTTACAAATAAAC
1681BE590634_1_B_2042041SBEFORWARD1772757.4629.634288.22T/C204CAAGAGCTAAATAGAACATATCAACAA
1682BE590634_1_B_2062061SBEFORWARD1792754.4425.934380.82G/T206AGAGCTAAATAGAACATATCAACAATA
1683BE590634_1_B_3143141SBEFORWARD2872754.0625.936279.26T/C314CTAGATAATCATCCTGTAATAAGAAAA
1684BE590634_1_B_3153151SBEFORWARD2882753.9225.936278.83T/C315TAGATAATCATCCTGTAATAAGAAAAC
1685BE590634_1_B_3163161SBEFORWARD2892757.6129.636289.91T/C316AGATAATCATCCTGTAATAAGAAAACG
1686BE590634_1_D_2092091SBEREVERSE2382764.6940.744281.76T/C209AAATTGGGAAGAAGGGACTACAGAATG
1687BE590745_4_B_93931SBEREVERSE1212661.3934.624282.69T/C93ACATGACTTCCCAACTTTTTTCTGTA
1688BE590745_4_B_1411411SBEFORWARD1142758.4725.936394.17T/C141GTCATGTATGATAAACAACAAACAAAA
1689BE590745_4_B_1411412SBEREVERSE1702756.0725.935180.78T/C141ATAGAGTGTTAGAATGATTTTTTGTGT
1690BE590745_4_B_1521521SBEFORWARD1252758.3922.224189.33A/T152TAAACAACAAACAAAAGTACACAAAAA
1691BE590745_4_B_1521522SBEREVERSE1792553.25367365.78A/T152CTTTAGCCTATAGAGTGTTAGAATG
1692BE590745_4_B_1711711SBEREVERSE2002757.9829.636392.68G/T171TAGATTTAGAAATGCAAGTTCCTTTAG
1693BE590748_4_A_2072071SBEREVERSE2362761.0333.334191.07T/C207GTAAATGGATTGAGTGAAGAAACAAGA
1694BE590748_4_D_2522521SBEFORWARD2252755.4629.635282.84T/C252TAGACATTTTCTCTTCTTTCTTTACTC
1695BE590748_4_D_2522522SBEREVERSE2812758.8129.634290.05T/C252GATGTAAGTACCGAGTTTTTTCTTTTT
1696BE590865_5_D_3433431SBEREVERSE3722759.0437.046395.88T/C343GTGCTTGTAGAAAGATCTAGTGAAATG
1697BE590942_4_A_3363361SBEFORWARD3092759.8829.636296.72G/T336CCGAGTATACCATATTTGTTTTGTTTT
1698BE590942_4_A_4334331SBEFORWARD4082562.73404375.99G/C433AGAATGTGAAAACTGTCGGATTGAC
1699BE590942_4_B_1661661SBEREVERSE1932562.88443273.22T/C166GCAGCAAAGAGACAAGACACACATA
1700BE590942_4_B_5185181SBEREVERSE5472764.629.634383.71T/C518AAAATAAACCCTTAAATCGCAAAACGA
1701BE590942_4_D_61611SBEREVERSE902761.9933.337393.42T/C61GGATCAGGACAGATTTAATCAAGAAAA
1702BE590942_4_D_3773771SBEFORWARD3502762.4229.634288.57T/C377ATATTTGTTTTGTTTTGTTTCGTGACC
1703BE591000_4_D_34341SBEREVERSE632762.533.338290.84A/C34CTTGACATTTAAATCCATAACCAGCAT
1704BE591000_4_D_86861SBEFORWARD602658.7234.627388.86T/C86AAGTGACTTGTATCTTCAGGATTGAT
1705BE591172_4_B_1481481SBEFORWARD1212760.6833.338296.29G/C148AAACATATTGCAATCTCTATGAGGCTA
1706BE591172_4_B_1481482SBEREVERSE1772760.9333.334394.71G/C148GTATTAGCAAACAAAACCTCGTTACAA
1707BE591195_4_A_1991991SBEFORWARD1732664.3238.465378.5T/C199GACGAACTGATGGCAAATTGTATGTT
1708BE591195_4_A_1991992SBEREVERSE2282760.3437.042293.56T/C199CTCACATTCTAACATCACAACATAAGC
1709BE591195_4_B_26261SBEFORWARD12558.77368281.3G/T26AATTAGCCATGACTAGGTTCTGTTT
1710BE591195_4_B_26262SBEREVERSE552761.9840.747393.44G/T26AGTTCGTCACAACTCACAATAACAGAC
1711BE591195_4_B_2642641SBEFORWARD2382662.6642.315383.47T/C264CTCTTTTTGAGTTACTTATGCGGGAG
1712BE591195_4_D_1071071SBEFORWARD822560.91324381.44T/C107GAACTGATGGCAATTTTATGTTTTG
1713BE591195_4_D_1071072SBEREVERSE1362761.933.334290.14T/C107TGCTCACATTCTTAACATCACAACATA
1714BE591222_3_B_1101101SBEREVERSE1392760.0137.046398.72T/C110CTTTCAAATATTAGTGGGGTGTGTACT
1715BE591222_3_B_3413411SBEREVERSE3702759.4733.336397.16G/T341TTGGTGTATATGCATCTCTTTACAAGT
1716BE591243_2_A_18181SBEREVERSE472758.6533.337395.32T/C18CCAACTTGGAAAGATAAATACCTCTAT
1717BE591243_2_A_1321321SBEFORWARD1052759.9737.047297.61T/C132TGTAATATCTGATAGCATCGTGTCTTC
1718BE591248_2_A_62621SBEFORWARD352762.2737.047290.89T/C62AATCCAGGATGTTTCTAGGTTTTCTTC
1719BE591248_2_A_2732731SBEFORWARD2482551.29288258.87A/T273TGGATGTATCTAGATGTATTTTAGT
1720BE591248_2_A_2912911SBEFORWARD2642753.6322.226176.31T/C291TATTTTAGTTCTAGATACATCCATTTT
1721BE591248_2_A_2932931SBEFORWARD2662756.9125.936186.16A/C293TTTTAGTTCTAGATACATCCATTTTCA
1722BE591248_2_B_1731731SBEFORWARD1462759.0433.334292.96T/C173TATCTACTTGCACATCTCAGTTTTTCT
1723BE591248_2_D_2982981SBEREVERSE3272757.6633.337392.36T/C298AGATAGATTACAAGTTGTGTCAGTCAA
1724BE591248_2_D_4194191SBEREVERSE4472663.8138.464277.73T/C419ATGTTTTAATCGTCGCTCTTGTTCAG
1725BE591248_2_D_4454451SBEFORWARD4182763.9537.044385.64T/C445AAACTGAACAAGAGCGACGATTAAAAC
1726BE591248_2_D_4454452SBEREVERSE4732663.9238.463375.37T/C445AGGAAGGATGACCAAAAAAAACTGAG
1727BE591273_7_A_3353351SBEFORWARD3092661.9838.463282.62A/T335AGTGAATAACCTGATGCTGAAACTTG
1728BE591273_7_D_39391SBEFORWARD142564.93404267.7G/C39TTTGCCGGTTTGGCTAATATCTTCT
1729BE591273_7_D_39392SBEREVERSE672664.5242.314275.61G/C39TTCTGCCTCAAACCAACTAGGAATCT
1730BE591273_7_D_2722721SBEREVERSE2992564.51484268.98T/C272CATACTCAAGCACCACGTTCCACTA
1731BE591275_5_A_10101SBEREVERSE392764.1237.043181.19T/C10TCAAACCATCCATTATCCTCTTCATCT
1732BE591275_5_A_2402401SBEREVERSE2672564.88488270.36T/C240GACTGAAGCTTCTTGAATGACTCGC
1733BE591275_5_A_5435431SBEFORWARD5162760.137.044397.2A/C543GTGGGTTCTTGTCCTTGTAAATAACTA
1734BE591275_5_A_5435432SBEREVERSE5722761.6433.334290.93A/C543GCAAATCAAAGACATCTACATTCCATA
1735BE591275_5_A_8128121SBEFORWARD7852753.9533.335379.97G/T812AGTTAGTTATCTTCTGTATGTAACCTG
1736BE591275_5_B_3683681SBEFORWARD3422662.9242.316383.33G/C368GATGAACAGCTGAGGAAAGAAGAATC
1737BE591275_5_B_7367361SBEFORWARD7112563.5485272.62T/C736CTTAAAGGCAAGTTCTACAGGACGG
1738BE591275_5_B_8788781SBEREVERSE9072761.7540.746190.18A/C878TCAATTGGTGCTACCCTAACTCTATCT
1739BE591275_5_B_111011101SBEFORWARD10852563.02486274.7T/C1110AAAGAACTAGCTATGGACAGGGGTG
1740BE591275_5_D_3513511SBEREVERSE3802761.7133.336393.63T/C351TGTCAGATTTGAGAAAACTCTACGAAA
1741BE591275_5_D_4204201SBEFORWARD3932760.2129.638297.71G/C420TGATCACAAATGTGTTATTTGACTCTT
1742BE591275_5_D_4854851SBEFORWARD4582761.3933.335292.28A/C485ACTCTCAGATTTAACGAAGAAAAATGG
1743BE591275_5_D_4854852SBEREVERSE5142763.7737.046387.44A/C485ATTCTTCTTTCCTCAGCTGTTCATCAT
1744BE591275_5_D_7157151SBEFORWARD6882760.6837.048397.95T/C715GATATTATTATCCTTTGGAGCTCATCC
1745BE591290_1_B_2532531SBEFORWARD2282563.92564169.08T/C253CTAGGACTGGTGAAGAGACAGAGGG
1746BE591290_1_B_2892891SBEREVERSE3172664.1438.464378.41T/C289ATCATCGTCTTCATCATCTTCCATGT
1747BE591305_7_B_5925921SBEFORWARD5652764.2648.156385.96T/C592ACGTCCTATAGTTGCACAGAGAAGGAG
1748BE591356_4_D_80801SBEFORWARD532752.1222.226375.11T/C80CAATTATAACATAAGTAACACAACATA
1749BE591356_4_D_80802SBEREVERSE1092759.4433.335396.45T/C80GGATTATGGGTTGTAATAAAAGTGAAC
1750BE591356_4_D_3633631SBEREVERSE3922758.1525.936393.2G/C363AATTGTAAGTTTAAGGCAGTTAACAAA
1751BE591356_4_D_7717711SBEREVERSE8002759.9537.045296.3G/T771AATAATACTGCTATTCCCCCTACATCT
1752BE591423_5_A_2772771SBEFORWARD2502764.7733.336279.81T/C277GTTCCTGATGCATTTTTTTTGTTTGAC
1753BE591423_5_A_2772772SBEREVERSE3062761.533.334291.35T/C277AGAATAAGAAAATGCAGAAGGAACTTG
1754BE591423_5_B_2152151SBEFORWARD1882764.5840.745384.39T/C215TGCTTCCTTGAGATAAAGCAGAGGTTA
1755BE591423_5_B_5805801SBEFORWARD5532761.829.632083.62T/C580CTCCTTTTCTCGTTTTCTTTCTTTTTT
1756BE591423_5_B_5805802SBEREVERSE6092758.2633.336291.87T/C580GGGTAAGATTACAAATATGAGAGTCAA
1757BE591466_3_B_1821821SBEFORWARD1552763.233.333387.26G/T182TCTTGATTTTTGTTCTCAGGGTTGATA
1758BE591501_1_B_6216211SBEREVERSE6502758.8737.046293.7T/C621AAGGTTCCTTCTATATTCTACACTTGC
1759BE591555_2_D_73731SBEFORWARD472662.0542.314283.03T/C73ACTGTTGATGAATGACACTAGAAGGC
1760BE591555_2_D_1521521SBEFORWARD1262664.942.316275.72T/C152GGTTTTACAAAAGCTGATGATGTCCC
1761BE591555_2_D_1881881SBEFORWARD1612763.1537.042285.14A/C188TAGAATGGAACAACACAGCAAGGTAAT
1762BE591555_2_D_1941941SBEREVERSE2232760.2733.334193.34T/C194ATCCCAACTGGTAAATAATCTGTGTAA
1763BE591555_2_D_2212211SBEFORWARD1942760.337.044396.6A/T221GTTTACACAGATTATTTACCAGTTGGG
1764BE591555_2_D_2212212SBEREVERSE2502764.0133.336386.72A/T221TAGGACTTAAGGTTTGCATTTTGCATT
1765BE591604_2_B_2422421SBEREVERSE2712763.3333.335286.46T/C242TAGGTAAGAAATGCTTCAACTGCAAAA
1766BE591739_4_A_28281SBEREVERSE572760.1433.336398.33A/T28AGATGGCATGAAGATTAATATCGTTAG
1767BE591739_4_A_1311311SBEREVERSE1592662.838.464382.44T/C131GTTTTGATGCTGTAGTTATCTCGCAA
1768BE591739_4_A_6226221SBEREVERSE6512764.4940.746283.6G/C622TGGGTAAGTAGTTTCCATTTTGTCTGC
1769BE591739_4_B_2542541SBEFORWARD2292564.72483166.04A/T254ATGAGCCCCTCCAGCAAATAACTAC
1770BE591739_4_D_2992991SBEREVERSE3272659.6434.626391T/C299TTCTGTGTGAAATCTATACAGCAATG
1771BE591739_4_D_5135131SBEFORWARD4872664.7142.313274.42T/C513AATAAGAGATGATTGGCAGGGACTTG
1772BE591739_4_D_6606601SBEFORWARD6342664.1142.312275.59T/C660GAAACTACCAACCCAAAGGAAACAAG
1773BE591739_4_D_6606602SBEREVERSE6892761.0737.044292.62T/C660GGAAGTCCATTACTTGCATATTAGGTT
1774BE591777_6_A_1151151SBEFORWARD902558.25407380.78T/C115TTAGAGTGAGTCTCAATGCCTAAAC
1775BE591777_6_A_1151152SBEREVERSE1442755.8229.635283.93T/C115ACACCAATAATTTAACTAAGCAGTATC
1776BE591777_6_A_1611611SBEFORWARD1342762.9633.333184.65T/C161TTATTGGTGTTGAGTGTTGACTTTTGA
1777BE591777_6_A_1611612SBEREVERSE1882561.56364377.09T/C161GAAAAAAGATTACCACACTTGCACA
1778BE591777_6_A_2032031SBEFORWARD1762761.2225.934391.63T/C203TAATCTTTTTTCCCCATTCGATAAATA
1779BE591777_6_A_2032032SBEREVERSE2312660.3738.466390.97T/C203AGTATATATCAGTGCAAACACGCAGT
1780BE591777_6_A_2062061SBEFORWARD1812561.08285379.15T/C206TTTTTTCCCCATTCGATAAATAAGA
1781BE591777_6_A_2062062SBEREVERSE2332561.9446278.06T/C206CCAGTATATATCAGTGCAAACACGC
1782BE591777_6_D_4034031SBEREVERSE4312664.1542.314378.38T/C403AACTAACCACCACAGAGACCCAATTT
1783BE591861_4_A_4224221SBEFORWARD3972559.99406283.73T/C422CTAGTACGATAAATCGGTTGCTGTT
1784BE591861_4_A_8488481SBEREVERSE8772758.4437.044291.15T/C848GTTAGAAGCAAGTATTGACCATGTAGT
1785BE591861_4_A_9969961SBEFORWARD9712564.6404370.36T/C996AAACAGCCAAGACCAATGAAGTTTG
1786BE591974_5_B_2212211SBEFORWARD1942757.429.636289.27T/C221AGTACTATTTTGAAGTTTGCCAGTTAT
1787BE591974_5_B_2212212SBEREVERSE2502759.6325.934396.38T/C221AAGAACATAAACCAATCAAATGAAGAT
1788BE591974_5_D_2772771SBEREVERSE3042564.78523267.54T/C277GAGGTTGCTGACGCTCTACTTTGAC
1789BE591974_5_D_2932931SBEFORWARD2662763.1637.044388.02G/T293TTTAATGCTCAAAGTCAAAGTAGAGCG
1790BE592047_4_A_1051051SBEREVERSE1342762.1740.746392.23T/C105TCTAGGGATATCAACACATACCCAGTT
1791BE592047_4_A_1581581SBEFORWARD1283056.8223.336369.22T/C158CCTAGATTATTCTGTTTAGTTTGATATTTT
1792BE592047_4_D_1361361SBEREVERSE1652761.2725.938396.18G/C136TAATGCATGCTTTCAAAAATATCAACT
1793BE604119_6_A_3613611SBEFORWARD3342759.9237.043396.64T/C361GTCTCACATCACATACACTCAAAAAGT
1794BE604119_6_A_3683681SBEFORWARD3412764.8237.045282T/C368ATCACATACACTCAAAAAGTGTGGCAA
1795BE604119_6_A_3683682SBEREVERSE3972763.6633.336286.12T/C368AAAATGAGAGCCACAAGCTTAAGAAAA
1796BE604119_6_A_4304301SBEFORWARD4032758.4833.336394.2T/C430CTAACTTTAGACAAGTATGGCAACATT
1797BE604119_6_A_6466461SBEFORWARD6192761.1133.338295T/C646ATTCGAGTTTTTAATTACTCCCTCCTT
1798BE604119_6_A_6736731SBEREVERSE7002561.7408381.56T/C673TCTAGCATTTGGTCAAAGTTAGCCT
1799BE604119_6_A_8678671SBEFORWARD8402759.0337.046294.18T/C867GCATTAGGACTTATATAGATGAAAGGG
1800BE604119_6_B_4544541SBEREVERSE4832763.7848.154182.83T/C454GTGTCCCTCTTTTCCATGTACTCTCTC
1801BE604119_6_B_4564561SBEFORWARD4292757.8125.935289.89T/C456TTCTCCAAAAACTTATATTTAGAAACG
1802BE604119_6_B_4564562SBEREVERSE4832561.57484176.14T/C456GTGTCCCTCTTTTCCATGTACTCTC
1803BE604119_6_B_7327321SBEFORWARD7052764.6629.633179.56T/C732ATTTTGTTTTGTTTTTCACCAGGGATT
1804BE604170_1_B_2072071SBEFORWARD1802760.4540.744192.81A/T207CCTGATGTTCCTATCCTATACCTCTTT
1805BE604721_6_A_2762761SBEFORWARD2492759.5133.335396.64T/C276CCTTTGATACTAAAATTGCCACTTACT
1806BE604721_6_D_4014011SBEFORWARD3742752.6522.224172.11A/T401GCTTATTTATATTTTTCTTATAGGTTC
1807BE604861_2_B_66661SBEREVERSE942660.0138.464289.12T/C66CCTGCACACTTCACAGTATCTTTATT
1808BE604861_2_B_3543541SBEREVERSE3832762.8437.044388.99T/C354AAATTACCCCTTCATAAACGAGAACTG
1809BE604885_3_A_2842841SBEREVERSE3132758.7533.334292.07T/C284GTAAAAATACTCTTGCATAATCAGTGG
1810BE604885_3_D_98981SBEFORWARD702859.1728.578289.16T/C98TGATGTAAAAATACTCTTGCATAATCAG
1811BE604885_3_D_1841841SBEFORWARD1592558.86408383.24A/T184AAGCTAATATGCATGTCAGTAGGTG
1812BE604885_3_D_1841842SBEREVERSE2112556.86285375.38A/T184AATTACTCCATTTTAGCAGGAATTA
1813BE604959_3_D_59591SBEFORWARD293056.04205366.24T/C59GTCATTATATTTGTTAATTTATGCTTTTAC
1814BE604959_3_D_59592SBEREVERSE882759.5529.636295.72T/C59AATAATTAAATGCCATACAAGGTAGGA
1815BE604959_3_D_81811SBEFORWARD552664.6742.315377.45T/C81TTACGGTCCTACCTTGTATGGCATTT
1816BE604959_3_D_1731731SBEFORWARD1482563.8524372.77T/C173GTCGCAGTAGTGTATGGACAGGCTA
1817BE605063_1_A_81811SBEFORWARD562564.11446169.76T/C81ACCATGCATTCTATACCAACCCAAC
1818BE605063_1_A_81812SBEREVERSE1102760.9540.746395.91T/C81GGTACCTCTAAATCGCACTACATTACA
1819BE605063_1_A_2522521SBEREVERSE2812757.1925.934185.75T/C252TTATTATTGATTTATCCTCTGACCTTT
1820BE605086_4_B_30301SBEFORWARD32758.7925.938396.38T/C30AATTGATCAAGGTATGGATATTTTCTT
1821BE605086_4_D_1501501SBEFORWARD1232760.7933.334395.12G/T150ATAGTTTACCCTACAAAATGTCGCTTT
1822BE605086_4_D_1501502SBEREVERSE1782663.7442.314277.95G/T150AATGTGTTTAATAGCGTGCTGACCTC
1823BE605086_4_D_2382381SBEFORWARD2112757.9729.637291.63A/T238TGTATCGATTAAATGTGTACAAAAGAG
1824BE605088_4_D_1871871SBEREVERSE2162764.2633.338285.54T/C187CATGCATGTTGATGAAGAACCTAAAAA
1825BE605088_4_D_1881881SBEREVERSE2162663.3534.628281.63T/C188CATGCATGTTGATGAAGAACCTAAAA
1826BE605088_4_D_2662661SBEFORWARD2392758.3237.045393.08T/C266CTAATGTTGGACTACCACTAATCAAGT
1827BE605088_4_D_2662662SBEREVERSE2932561.29365380.91T/C266TGAGTAGGCCCTTTAATTCATTCAT
1828BE605088_4_D_3233231SBEREVERSE3522761.540.746394.26T/C323ATTCAAGGACTAGAAGTCTGTGTTTCC
1829BE605088_4_D_4134131SBEREVERSE4422761.9829.634391.56A/T413TTATGATGCCACTATGAAATTGCTAAA
1830BE605194_7_B_5545541SBEFORWARD5272759.8144.445295.9A/C554GTGAGTAGAAAGTCGTGTCTCCTAGAT
1831BE605194_7_B_5835831SBEREVERSE6102561.59364379.41T/C583AGCTCCTATGCAAATTCTCAAACAT
1832BE605194_7_B_115011501SBEREVERSE11782660.9238.467288.29T/C1150CTTTAGAATCAGATTTGCACTTCCTC
1833BE605218_6_D_44441SBEREVERSE732754.4829.636382.2G/C44TGATCATCTATAAACTGTATTCCTTAC
1834BE606438_2_D_53531SBEFORWARD282562.73444375.98G/T53ATTGTTCAGATGTATGAGGTCAGGC
1835BE606541_6_B_5665661SBEFORWARD5392764.8837.043280.55A/C566TAGGTTCGGTTGTTGTTTTTCAGACAT
1836BE606541_6_B_6766761SBEFORWARD6492762.6833.336187.39T/C676ATGTGACGTCTTGTTTTCTTTTATTGG
1837BE606541_6_B_6766762SBEREVERSE7032562.53444376.56T/C676CTACAAAGAAGAAACCATCTCGACG
1838BE606541_6_D_4384381SBEFORWARD4132560.59366281.99T/C438CGAAATCTTTCTTCAGGTTTCTCTT
1839BE607036_1_A_3343341SBEFORWARD3072764.5637.046280.8A/T334GTCATTCGCATGCTAGACCTAAAAAAA
1840BE607043_6_A_1631631SBEREVERSE1922763.337.044285.92T/C163CAACACCTATTTTCATACCTGATTGGA
1841BE607065_5_B_3283281SBEREVERSE3572760.4240.744294.58T/C328GTACAACTCTGGTATGGAAACTATTGG
1842BE636795_5_A_5555551SBEFORWARD5282759.1640.746396.22T/C555TTAGTCCTTGTGTATATAGTCGGAGTG
1843BE636802_2_D_50501SBEFORWARD252563.67443270.85T/C50GCCAGTTCGCTGTCATAAGTTCATA
1844BE636872_6_A_46461SBEREVERSE752760.333.333192.64G/C46ATACAAAACCAACATAGGGAACTAACA
1845BE636872_6_A_59591SBEFORWARD322760.9437.047294.89T/C59TTCATAGTCTTTGACATGTTAGTTCCC
1846BE636872_6_A_59592SBEREVERSE882759.8237.048297.79T/C59CTGCTACAGGTATATACAAAACCAACA
1847BE636872_6_A_1361361SBEREVERSE1652752.1122.225374.45T/C136TTCTCTAATACAAAACTATTAACCTAA
1848BE636872_6_A_2012011SBEFORWARD1762562.23365378.09A/T201CAATTTGGGAATACTGGTTTCATGT
1849BE636872_6_A_2012012SBEREVERSE2302758.3925.934392.66A/T201AGAATCATCAAGAAATAATAAATGCAG
1850BE636872_6_A_2032031SBEREVERSE2332858.9528.573285.38G/C203GGTAGAATCATCAAGAAATAATAAATGC
1851BE636872_6_A_5175171SBEFORWARD4912663.3338.466280.41T/C517GTCAAAAGCTTAAGATCAAATGTGCC
1852BE636872_6_A_5175172SBEREVERSE5462764.840.744281.43T/C517GAAAGTGGAACCTGCAAGAAGAATGTA
1853BE636872_6_D_34341SBEREVERSE632757.0629.636389.92G/T34TGCATAGGAATACTTCTCTAATACAAA
1854BE636872_6_D_82821SBEREVERSE1112757.225.934389.09A/T82TCATCAAGAAATAATAAATGCAGATAC
1855BE636872_6_D_99991SBEFORWARD722759.3429.634293.85A/T99TACTGGTTTCATGTATCTGCATTTATT
1856BE636872_6_D_3763761SBEFORWARD3492757.0329.636389.85T/C376TGTTTTACCTATGTATTCTTATGGATG
1857BE636872_6_D_3993991SBEFORWARD3722764.3937.048386.83T/C399GATGCGTTAAGCATACAGAAATGTCAA
1858BE636872_6_D_4704701SBEFORWARD4432764.0640.747387.2G/T470ACTTTCTCTGGCGATAAAGATCACATC
1859BE636872_6_D_5935931SBEFORWARD5662764.4240.744384.25G/C593ATCCTCCGTTGGTGATAGGAAAATTAC
1860BE636872_6_D_6296291SBEFORWARD6022763.4337.044387.2T/C629CATCGCATCACTTATTGGTAACAGAAT
1861BE636872_6_D_6626621SBEREVERSE6912756.5533.338287.97A/T662TAGACATGTATAAGTCAGAAAAGGAAC
1862BE636954_5_A_61611SBEREVERSE902759.4937.044294.31T/C61AAAGTAGGAAATAATACTCAGGCACAC
1863BE636954_5_A_69691SBEREVERSE982757.5229.634387.82T/C69CAAGCAAAAAAGTAGGAAATAATACTC
1864BE636954_5_A_4814811SBEFORWARD4542763.6540.744386.54T/C481CTTTTCTGCTTACCTTTAACAGCTTGG
1865BE637255_4_A_1181181SBEFORWARD912758.5333.334291.41T/C118TTACTAGCTTGGTGTACTTAAAAATGG
1866BE637255_4_A_1181182SBEREVERSE1472757.2425.934287.56T/C118ACTTCCAAGAAAATAACTCCATAAATA
1867BE637255_4_B_3123121SBEFORWARD2852760.7533.333292.95T/C312CAACAAACCCCTAAATAAAAACTAAGC
1868BE637255_4_B_3123122SBEREVERSE3392556.36246269.63T/C312GATTTTTTTTAAAGGATCAACATCT
1869BE637255_4_B_5175171SBEFORWARD4902756.3729.636387.86T/C517GCAACCATGTTATAATTCTGTTAGTAT
1870BE637476_7_D_3253251SBEFORWARD2992661.7838.465386.12T/C325GGATGTATCAAGGCAAATCTAAGACA
1871BE637485_5_B_2192191SBEFORWARD1922758.8137.044393.92T/C219AGTGACCAATAAACTATCACATACCAC
1872BE637507_4_A_1721721SBEREVERSE2012763.5437.045285.84T/C172ACTGAATCAACAGAAACAGCGTCTAAA
1873BE637507_4_A_2962961SBEREVERSE3252761.4837.047394.94T/C296TTCTTGGTATTGTACTCAACAAGGCTA
1874BE637808_4_A_1471471SBEREVERSE1762764.4240.743180.27T/C147CTCATTTTGAAGAGAATCCAACAGACC
1875BE637808_4_A_5385381SBEFORWARD5112763.3337.046388.75T/C538AGGATGTCGTTTTCAAACACTCTGTAA
1876BE637808_4_B_6316311SBEFORWARD6042764.5540.744282.18T/C631TGCTAATACTTGGCTATTTCCTTGACG
1877BE637808_4_B_6316312SBEREVERSE6602760.2137.047398.75T/C631CAATTCTGAGAAGTAAGAAAGTCCTTG
1878BE637838_7_A_2082081SBEREVERSE2372756.7433.335286.68T/C208TCAGATAAGTAATATGCAGAAGAGAAC
1879BE637838_7_A_5745741SBEREVERSE6012559.73364383.37T/C574CATATTTATTTGGTACGGCAGCTAT
1880BE637838_5_A_7857851SBEFORWARD7602564.2445270.53T/C785AAGTAATTCGGAACGGAGGGAGTAA
1881BE637838_5_A_7857852SBEREVERSE8142759.0437.046395.86T/C785GTCCCTCTCTAAAGAAATATAAGAGCA
1882BE637838_5_B_106210621SBEFORWARD10362661.2834.626388.25G/C1062GCAATGTAGTTACAATTTACATGCCA
1883BE637838_5_B_106210622SBEREVERSE10902659.3742.315389.55G/C1062CAAACTACTTATCTGACAGTGTGTGC
1884BE637864_1_A_50501SBEREVERSE792759.7629.636398.03T/C50ACATGACATTAATTCTCAAGGAAAACT
1885BE637864_1_B_2982981SBEREVERSE3272757.5625.938392.68G/T298AAAAATAAAATGTTATGTGGATAGCTC
1886BE637864_1_B_3033031SBEREVERSE3322757.5625.938392.68G/T303AAAAATAAAATGTTATGTGGATAGCTC
1887BE637911_6_B_3573571SBEREVERSE3842564.2528374.06T/C357CCACGAGATCTGGAGGTAGTAATGG
1888BE637971_1_B_1081081SBEFORWARD812757.5625.936391.42G/T108ATGTTAACTGTGCTATCAAATCAAATA
1889BE637971_1_B_1371371SBEFORWARD1102756.6225.936388.61T/C137TTTGATTTTCTTAACTCAATAGACAAC
1890BE637971_1_B_1371372SBEREVERSE1642561.65406177.12T/C137CACAATATTCCATTACAGGCACAAC
1891BE637971_1_B_1391391SBEFORWARD1122761.0133.334191.12G/T139TGATTTTCTTAACTCAATAGACAACGG
1892BE637971_1_B_1391392SBEREVERSE1662563.77406272.44G/T139AGCACAATATTCCATTACAGGCACA
1893BE637971_1_B_1471471SBEREVERSE1762760.4533.336397.41G/T147AGCATATAGGAGCACAATATTCCATTA
1894BE637971_1_B_1811811SBEFORWARD1542759.1133.336396.07T/C181GAATATTGTGCTCCTATATGCTATTGA
1895BE637971_1_B_1811812SBEREVERSE2102760.0725.934295.62T/C181AAAAATCTGAAAGAAGCATGTCTAAAA
1896BE637971_1_B_1861861SBEFORWARD1592760.6833.334395.46A/T186TTGTGCTCCTATATGCTATTGATCTTT
1897BE637971_1_B_1861862SBEREVERSE2132560.61364382.32A/T186CAGAAAAATCTGAAAGAAGCATGTC
1898BE637971_1_B_2052051SBEFORWARD1782761.833.334392.11A/T205TGATCTTTTAGACATGCTTCTTTCAGA
1899BE637971_1_B_2162161SBEFORWARD1912564.9404166.14T/C216ATGCTTCTTTCAGATTTTTCTGCCC
1900BE637971_1_B_2162162SBEREVERSE2452762.7837.048188.33T/C216ATTTTACAGCTATAACCCTGCCATTTC
1901BE637971_1_B_2592591SBEFORWARD2332652.6323.086369.98T/C259TAGCTGTAAAATGTTCTTTTATCTAT
1902BE637971_1_B_2712711SBEFORWARD2442755.4729.633383.28T/C271TGTTCTTTTATCTATGTTGTGTCTTAG
1903BE637971_1_B_3433431SBEFORWARD3162758.2433.336291.81T/C343CATCTATGTTATCGATTTAGGATCTGT
1904BE637971_1_B_3463461SBEFORWARD3192760.8837.046294.46T/C346CTATGTTATCGATTTAGGATCTGTCCA
1905BE637971_1_D_18181SBEREVERSE472761.1129.634292.49T/C18ATCAAAAACATAAACTCATACGTCCAA
1906BE637971_1_D_29291SBEREVERSE582758.6125.934190T/C29TCTCATTAACCATCAAAAACATAAACT
1907BE637971_1_D_1671671SBEFORWARD1412660.7838.466389.75T/C167CCTGTAATGGAATATTGTGCTCCTAT
1908BE637971_1_D_1671672SBEREVERSE1962763.9640.744283.95T/C167ACGAAGCATGTCTAAAAGGTCAATAGC
1909BE638137_6_B_1161161SBEREVERSE1452763.3644.444184.07T/C116CTCCTCTCATCCCTAGAGTCATCATTT
1910BE638137_6_B_2062061SBEFORWARD1812564.12405270.77T/C206ATACAAAGGCGACGATGATTCAGAT
1911BE638137_6_B_4784781SBEFORWARD4512758.1829.638394.54T/C478CGAAAAATATATTCAGTTGTTAGCTTC
1912BF145268_4_D_3513511SBEFORWARD3242755.8425.937386.91A/T351AACCACATAGTCTATTTCATTATCATT
1913BF145459_4_B_3383381SBEREVERSE3662662.3746.154383.73T/C338GCAAGATCGTACCACATTCTACACTC
1914BF145459_4_B_5175171SBEFORWARD4922563.27484374.35T/C517CGTTCTTGACGTGGTAATCAGCTAC
1915BF145459_4_B_5665661SBEREVERSE5932562.86403273.29T/C566ACAACAAGAAAGCCATTAGCATCTG
1916BF145459_4_B_5725721SBEREVERSE6002662.9438.463178.05T/C572AAAGGACACAACAAGAAAGCCATTAG
1917BF145459_4_D_2462461SBEFORWARD2202664.44506277.1A/C246TCTCTCAGGAGATGAAGGATCTAGGG
1918BF145459_4_D_2462462SBEREVERSE2732560.58408384.92A/C246AAATGTATCCATTGCCTACCTCTCT
1919BF145459_4_D_2642641SBEFORWARD2372762.8248.154389.05G/T264GATCTAGGGATAGAGAGGTAGGCAATG
1920BF145459_4_D_2642642SBEREVERSE2912564.32445270.18G/T264AGAGGAGGTCATGGCAAGAAATGTA
1921BF145459_4_D_3283281SBEFORWARD3012764.8740.745281.85A/C328CTGAAGGTGGAACATTAGGTTGATTTG
1922BF145459_4_D_3283282SBEREVERSE3562661.7946.155284.41A/C328GCTCTACAAGAGTAACCAGCACATTC
1923BF145580_2_A_2212211SBEREVERSE2492662.2138.464384.19T/C221AATGTCTAATCACCTTCTCCACATGA
1924BF145580_2_D_3323321SBEFORWARD3052761.1829.638396.47T/C332GATAATTATTTGTGTTCATGCAAAAGC
1925BF145580_2_D_3323322SBEREVERSE3612756.3729.636387.86T/C332CTAAGATATTGTCATGAATTGGTAACT
1926BF146221_2_B_1971971SBEREVERSE2262758.7229.634391.44A/T197CTTATTCCCTCCGTAAAAAAGTATAAA
1927BF146221_2_B_2082081SBEREVERSE2352564.98484369.24T/C208AGGTACGCACTTATTCCCTCCGTAA
1928BF200525_7_B_72721SBEFORWARD452758.3737.043188.66T/C72TAGAGATTCCAACAAAGGACTACATAC
1929BF200525_7_B_72722SBEREVERSE1012761.6933.335291.4T/C72TTAAAGGGTAGATTCACTCATTTTGCT
1930BF200531_1_A_1771771SBEREVERSE2062762.2237.046290.43G/C177GAATTACAATTAGGAGTGATTTGTGGC
1931BF200531_1_A_2082081SBEFORWARD1812758.9329.636395.54A/C208TCCTAATTGTAATTCTTGGTAACATTG
1932BF200549_3_B_2202201SBEREVERSE2492756.2333.335285.14T/C220AGAATGTAACTTATGTAGGAGTACGAA
1933BF200640_1_B_57571SBEFORWARD312663.8338.468381.85T/C57ATCAACAGATCTATTTTGCGACTTGC
1934BF200640_1_B_57572SBEREVERSE842560.73364277.9T/C57CATCTGTAGAACCACCAAAAAAGAA
1935BF200640_1_B_4634631SBEREVERSE4902562.24443275.15T/C463GCTTGCTGAAGGACTATCTTGACAT
1936BF200640_1_B_4894891SBEFORWARD4632659.7642.314390.12T/C489GTATGTCAAGATAGTCCTTCAGCAAG
1937BF200644_6_A_1661661SBEFORWARD1392754.4325.934279.13G/T166GGATTTCTACCTTTATGTTTACTTATT
1938BF200644_6_A_1661662SBEREVERSE1962854.7428.576376.29G/T166CATATAGCATACATGACCTATAAAAGTA
1939BF200742_1_D_4754751SBEREVERSE5042762.5733.336187.7T/C475TTGGAAACTATGATTCCTTTTACGATG
1940BF200773_6_B_1541541SBEFORWARD1272761.3444.444393.47T/C154AGCTAGATGGTACTTCATATCCTCACC
1941BF200773_6_B_4084081SBEFORWARD3822664.9346.155376.66T/C408CTGCACCTCAAGTTGGTTCTCTTGTA
1942BF200773_6_D_3103101SBEFORWARD2832759.8133.334295.27G/T310TACATCCGTTTCTGGTAAGTTTAGTTT
1943BF200773_6_D_3533531SBEFORWARD3262764.8337.044281.35A/T353AGAACTGACCATGATATGCCAATGTTT
1944BF200774_3_A_2822821SBEFORWARD2552760.633.336193.62T/C282TAAGTACTCACTCCGTCCAAAAATAAA
1945BF200774_3_A_6086081SBEFORWARD5812758.1429.634391.91T/C608CTTATTTAGCACACACAAAGTAATTCA
1946BF200942_3_A_4004001SBEFORWARD3732754.3729.636381.86T/C400CAGCTTATATCATTCTAATTACATCTC
1947BF200942_3_A_4004002SBEREVERSE4292761.4229.638395.74T/C400CATTTGTAATTCAGATGAATGGATGTT
1948BF200942_3_A_4054051SBEFORWARD3782753.1625.936276.57A/C405TATATCATTCTAATTACATCTCACAAC
1949BF200942_3_A_4504501SBEREVERSE4792764.5640.746385.08T/C450ATACAGAGACATGGCTGCAACTCTTTT
1950BF200942_3_A_5085081SBEFORWARD4832561.52366380.86G/C508CATGCCCTTTGGTTTATAACAATCT
1951BF200942_3_A_5655651SBEFORWARD5392661.1742.314285.66T/C565GTGTATGTGTACGATGTTCTGCTTTC
1952BF200942_3_A_6176171SBEFORWARD591266438.464378.82A/T617GAATGCTTCTTCCAAGTTTCAGTCAA
1953BF200942_3_A_6176172SBEREVERSE6442561.88365175.81A/T617CGCATAACAAATTCAGAACAAACAC
1954BF200942_3_A_6426421SBEFORWARD6152759.6825.935193.82T/C642AAATGTGTTTGTTCTGAATTTGTTATG
1955BF200942_3_A_6426422SBEREVERSE6712755.0222.224278.66T/C642CAAATGATATACTAATAAAAAATGACG
1956BF200942_3_A_6786781SBEFORWARD6532550.02204252.57T/C678TTATTAGTATATCATTTGAAGTTTG
1957BF200942_3_A_6786782SBEREVERSE7072762.6937.044287.78T/C678GTATTAAAAATCAGGACCGCCAATAGT
1958BF200942_3_A_7067061SBEREVERSE7352763.6137.045285.62T/C706TTTTTAACGACTCCAATCTGATGACAC
1959BF200942_3_A_7087081SBEREVERSE7372763.1337.045287.07T/C708CATTTTTAACGACTCCAATCTGATGAC
1960BF200942_3_A_7117111SBEFORWARD6862563.89444372.51T/C711GGCGGTCCTGATTTTTAATACTGTG
1961BF200942_3_A_7877871SBEFORWARD7602757.7637.044390.77T/C787ATCAAGAGCTATGGTATGTTCTCTAAC
1962BF200942_3_A_8078071SBEFORWARD7802762.0844.444391.26T/C807CTCTAACTGTCTTCTTTGTGCTCACTG
1963BF200942_3_D_4464461SBEREVERSE4752762.5533.338290.68T/C446ATTTGTAATTCAGATGAATGGAGGTTG
1964BF201102_5_A_1541541SBEFORWARD1272753.1125.935377.46T/C154ACTTTTACTAACGACATCTTTTACTAT
1965BF201102_5_A_3333331SBEFORWARD3062764.0237.047285.65T/C333TGACGTTAGCCTGCCTAATTGTTATTT
1966BF201102_5_A_4414411SBEFORWARD4142755.9825.934283.78G/T441TAAACTATTTCTTATTCCTACATTTGC
1967BF201102_5_B_4424421SBEREVERSE4712762.5340.744288.23A/T442GCTGCTTAACTCTGTAATCATATTGGC
1968BF201102_5_B_5485481SBEFORWARD5232564.92403165.45T/C548AAGGTTGTTTGCGTGCTTGTATTGT
1969BF201102_5_D_6886881SBEFORWARD6632564.29444269.62T/C688CGATGCTGGTAGGATTACATGGTTT
1970BF201102_5_D_7737731SBEFORWARD7462759.333.338296.25T/C773ATTATAATCCCTGCGATATGAGAATAG
1971BF201102_5_D_7737732SBEREVERSE8022761.5337.046394.16T/C773TTCTTAACTCTGTAATCACACTGGCAT
1972BF201235_2_A_1941941SBEREVERSE2232764.9837.045281.51T/C194AAAAGAATGTCAGTATTGGTTGCAGGA
1973BF201235_2_A_2012011SBEREVERSE2302761.5533.335393.48T/C201AACAAGGAAAAGAATGTCAGTATTGGT
1974BF201235_2_A_2062061SBEREVERSE2332555.65325371.73T/C206ACTAACAAGGAAAAGAATGTCAGTA
1975BF201235_2_A_2152151SBEFORWARD1902564.96484369.29T/C215GGTTTGTCCTGCAACCAATACTGAC
1976BF201235_2_A_2152152SBEREVERSE2442758.8925.936192.09T/C215TTGTAAACAAAACTAACAAGGAAAAGA
1977BF201235_2_A_2242241SBEFORWARD1982662.2838.465384.63G/C224CTGCAACCAATACTGACATTCTTTTC
1978BF201235_2_A_2272271SBEFORWARD2012660.9334.625287.01G/C227CAACCAATACTGACATTCTTTTCCTT
1979BF201235_2_A_2442441SBEREVERSE2732762.0729.634185.36T/C244GGGAATAAACAAGATTAAAAAAATGGG
1980BF201235_2_A_2452451SBEREVERSE2742760.2125.934190.94T/C245AGGGAATAAACAAGATTAAAAAAATGG
1981BF201235_2_A_2702701SBEFORWARD2452555.92204369.12T/C270ACCCATTTTTTTAATCTTGTTTATT
1982BF201235_2_A_2702702SBEREVERSE2992755.5325.936283.67T/C270GGAATAAGTAAATGTTTAAGAAATCAG
1983BF201235_2_A_3013011SBEFORWARD2742753.4622.226277.45T/C301GATTTCTTAAACATTTACTTATTCCTA
1984BF201235_2_A_3603601SBEFORWARD3352564.77443267.58T/C360ATCTTGGTCTGTTGGTTGAGAATGC
1985BF201235_2_B_2862861SBEFORWARD2602664.4346.158278.37T/C286CTGCAACCAGTACTGACGTTCTTTTC
1986BF201235_2_B_2862862SBEREVERSE3142661.1738.466388.58T/C286GGCACTCCTTGTAAACAAAACTAAGA
1987BF201235_2_D_2812811SBEFORWARD2562562.97448276.1G/C281CTGCAACCAGTACTGACGTTCTTTT
1988BF201235_2_D_2812812SBEREVERSE3102762.1537.046392.31G/C281GGCACTCCTTGTAAACAAAACTAAGAA
1989BF201235_2_D_3113111SBEFORWARD2842763.8440.746285.56A/T311TCTTAGTTTTGTTTACAAGGAGTGCCC
1990BF201235_2_D_3113112SBEREVERSE3402761.4725.934288.84A/T311TCGGGAAAGATAACAAGATTAAAAAAA
1991BF201235_2_D_3203201SBEFORWARD2932764.933.334277.79A/T320TGTTTACAAGGAGTGCCCTTTTTTTTT
1992BF201235_2_D_3203202SBEREVERSE3492761.629.634291.02A/T320TTTAAGAAATCGGGAAAGATAACAAGA
1993BF201235_2_D_3693691SBEFORWARD3422753.7325.936278.28T/C369TCTTAAACATTTACTTATCCTACAACT
1994BF201388_7_B_2562561SBEREVERSE2852759.1229.634394.87G/T256ATATTCATCTTCCAGAGCCTAAATAAA
1995BF201388_7_B_2882881SBEFORWARD2612762.5637.044186.49T/C288ATTTAGGCTCTGGAAGATGAATATGGT
1996BF201426_6_A_6246241SBEREVERSE6532757.0933.334388.76G/C624GAGATATTTGATTAGGTTGCTTACTCT
1997BF201426_6_D_3333331SBEFORWARD3052858.1139.296284.74T/C333CGGATGTATATAGACGTAGTTTAGAGTG
1998BF201426_6_D_3333332SBEREVERSE3602564.54443369.94T/C333GAGCAAGGAGCAAAATGAGTGAATC
1999BF201449_4_D_1721721SBEREVERSE2002664.5834.627277.31A/T172AGTAAACAACCATGCCATGTCAAAAA
2000BF201449_4_D_3043041SBEREVERSE3322663.7938.462174.89T/C304CAAGCAAGAATAGAAGGCGACAATAA
2001BF201449_4_D_3763761SBEFORWARD3492761.833.334290.43T/C376TTTCTCAACATGGTTTGTCTTAATCTG
2002BF201533_2_A_2712711SBEREVERSE3002756.4733.336388.17T/C271AAGACTGTGTATACGAAGCTAATAGAA
2003BF201533_2_A_3573571SBEREVERSE3852661.642.315285T/C357GAACTCATCATAGTCGAAATCGTAGC
2004BF201533_2_D_2622621SBEFORWARD2372564.17404270A/C262CAAATCGTTCTGATGTTTCTTGCTG
2005BF201533_2_D_2622622SBEREVERSE2912764.3937.044282.66A/C262TTAACTGTCGTTGACTTCTTTTGCTGA
2006BF201560_7_A_66661SBEREVERSE952759.9937.045398.11A/C66AAACTAGCCGCTTCTTAATAGGTAATC
2007BF201652_7_B_1331331SBEFORWARD1072664.3238.465276.83T/C133ATCATCAGGATCACATTCATAATCGC
2008BF201830_2_B_2152151SBEREVERSE2422563.8446374.01A/T215AGCATTGAGATGCATGACGTTACTC
2009BF201830_2_D_3923921SBEFORWARD3652757.3433.334389.52A/C392ACTTCCTTATGAGATGTAACTTGACTT
2010BF201830_2_D_3923922SBEREVERSE4192565363263.28A/C392CAAGTTACACCCCGCAAAAAAAAAT
2011BF202329_6_A_1491491SBEREVERSE1762563.25443373.8T/C149CTTCTGGATACTTCTGCTGCTTGAA
2012BF202329_6_D_2402401SBEREVERSE2682662.0434.624283.05A/T240AACCACCAAGATTTTCTATCATCACA
2013BF202329_6_D_5105101SBEFORWARD4832764.4337.048285.03T/C510TTTGTTGACTGCAGTTCTGTTTTGTCT
2014BF202635_3_D_4594591SBEFORWARD4322759.8529.635194.33G/T459AGTTACTTGCTATTTGTGTTGGTTTTT
2015BF202635_3_D_4594592SBEREVERSE4872664.0142.314277.13G/T459ACTATCACCAGCCATGTAAAGAACCA
2016BF202643_1_D_3393391SBEFORWARD3122761.637.044392.7A/C339TAGTGCATGGGATACCTAAGAAAAGTT
2017BF202643_1_D_3393392SBEREVERSE3682763.0225.934283.08A/C339TTCGGTATCCGTAAAAAAAAAAGAAAA
2018BF202681_2_A_3023021SBEREVERSE3312757.2533.337289.45G/T302CTATTACTAATTGTATTTTAGGCACCC
2019BF202706_4_A_1481481SBEREVERSE1762661.542.314284.65T/C148CAGTACAACACCATCCTTAGTCATCA
2020BF202706_4_D_1331331SBEFORWARD1072662.4642.314281.77T/C133CTTATGATGCTGATCCTTCTGCTATG
2021BF202806_7_B_2112111SBEREVERSE2392663.1446.154279.75T/C211GATACGGCCACAAGAACAGGTAATAG
2022BF202810_6_B_5955951SBEREVERSE6232664.0638.465277.61T/C595CACGAAATACAATGGAGACCCATAAA
2023BF202810_6_B_6076071SBEREVERSE6342560.89326382.74T/C607CCAAAATTTAGCACGAAATACAATG
2024BF202810_6_B_6096091SBEREVERSE6362564.15367271.93T/C609GGCCAAAATTTAGCACGAAATACAA
2025BF202810_6_B_6196191SBEFORWARD5932662.5538.465180.47T/C619CGAGTTTATGGGTCTCCATTGTATTT
2026BF202810_6_B_6636631SBEFORWARD6362756.4522.227388.73T/C663ATAGATTAAATTAACAAAATGTTCACG
2027BF202810_6_B_6876871SBEREVERSE7162760.6729.635396.11T/C687CATTGGATTCGTATTTGAACATAGTTT
2028BF202810_6_B_129512951SBEFORWARD12682757.5422.226391.37A/T1295TTATTATTATTTTCTTTTCGAAGTGCT
2029BF202810_6_B_129512952SBEREVERSE13242758.433.336393.95A/T1295ATAGAACGGAGGGAGTACTTTTTATTA
2030BF202810_6_B_133813381SBEFORWARD13122662.1342.316385.69T/C1338CCTCCGTTCTATAAACATAAGAGCGT
2031BF202810_6_D_9359351SBEFORWARD9082758.0633.336392.93T/C935ACATTATCTTTGGTAGTGCTACAACTT
2032BF202810_6_D_9359352SBEREVERSE9622564.93405370.02T/C935AATTCACTTTGCAGCAGTTTCAAGC
2033BF203070_3_A_1441441SBEFORWARD1162857.6821.435179.03T/C144CAATTTTTTGTTTACTAATTGTGTTTCT
2034BF203070_3_A_1441442SBEREVERSE1732762.1333.336290.69T/C144AATATTTGGTTGATTGTGGATGCTACT
2035BF203070_3_A_3573571SBEREVERSE3862755.9833.334385.43G/T357TTTTTGAGTATCTTGTTACCTCTAGTC
2036BF203070_3_B_1811811SBEREVERSE2102763.6333.333386T/C181AATCTGTCATTTTGAGCATTTGATGTC
2037BF203070_3_B_1831831SBEREVERSE2122764.433.335384.91G/T183ACAATCTGTCATTTTGAGCATTTGATG
2038BF203070_3_B_1841841SBEFORWARD1592554.48247369.47T/C184ATTTCAAATGACAACATGTAAATAG
2039BF203070_3_B_1841842SBEREVERSE2132763.1429.635388.69T/C184AACAATCTGTCATTTTGAGCATTTGAT
2040BF203070_3_B_2102101SBEFORWARD1832763.6333.333386G/T210GACATCAAATGCTCAAAATGACAGATT
2041BF203070_3_B_2102102SBEREVERSE2392757.6329.636289.98G/T210TGATGTACAAAAGTGAAGGTAAGAATA
2042BF203070_3_B_2162161SBEREVERSE2432560.2406384.81G/C216ACCCTGATGTACAAAAGTGAAGGTA
2043BF203070_3_B_2172171SBEREVERSE2442562.62446377.55T/C217CACCCTGATGTACAAAAGTGAAGGT
2044BF203070_3_B_2372371SBEREVERSE2662761.237.047395.79T/C237AAGTTCCCTTTAAATAGTATTCCACCC
2045BF203070_3_B_3283281SBEFORWARD3012759.3840.745396.28T/C328CAACTCGACTAGAGGTAACAAGATACA
2046BF203070_3_B_3293291SBEFORWARD3022757.7840.745391.47A/T329AACTCGACTAGAGGTAACAAGATACAC
2047BF203070_3_B_3303301SBEFORWARD3032758.9540.745293.31T/C330ACTCGACTAGAGGTAACAAGATACACA
2048BF203070_3_B_3463461SBEREVERSE3752757.5829.636391.49A/C346TTCGCATATTTGTACACACTTATATCT
2049BF203070_3_B_3733731SBEFORWARD3462760.1137.046398.43T/C373CCAGATATAAGTGTGTACAAATATGCG
2050BF291319_5_D_39391SBEFORWARD122764.1340.744283.45G/T39AAGGAACGAGGATAGTCCAATGATGTA
2051BF291549_1_B_3233231SBEFORWARD2962761.833.334392.1T/C323TCAGTTGAAATTATGTGACTTTGGAAG
2052BF291549_1_B_3233232SBEREVERSE3502564.42448271.73T/C323ATGTGTGATCATACCAGCACTTTCG
2053BF291549_1_D_1931931SBEFORWARD1682564.53443166.61T/C193ATCATACCAACACTTTCGCACTTCC
2054BF291608_7_B_5545541SBEREVERSE5822661.8434.624385.31G/T554CTTCCGCAAACACTATATTCAAAGAA
2055BF291608_7_B_6066061SBEFORWARD5802660.0934.628291.4T/C606AGCACATATGTCCATGTTATTGTCTT
2056BF291674_2_B_40401SBEFORWARD142656.0230.778279.74T/C40TCATTTACGTAATTACTGTTCTGTTC
2057BF291720_3_B_3693691SBEFORWARD3422759.9533.335397.97G/T369TAAGTTGTAAGGTTTGGTTTAAGCACT
2058BF291720_3_B_4394391SBEREVERSE4662564.18443371T/C439CCCCTAAGAAGCATAAAAAGGTTGC
2059BF291720_3_D_1771771SBEFORWARD1522556.13368273.4T/C177AACTAGTTAGGTTTGTGGTTCTTCT
2060BF291720_3_D_4714711SBEFORWARD4452660.5734.626288.72T/C471GATTTTGGAGAAAATTTACACTCTGG
2061BF291774_6_A_1601601SBEFORWARD1332762.6637.044389.51T/C160TATTACTCCTTTGTTTGTGTTGAAGGG
2062BF291774_6_A_4004001SBEFORWARD3732762.637.046390.96T/C400ATCCGACTAGCATTCGTATTGATTATG
2063BF291774_6_A_4814811SBEREVERSE5102761.9244.443391.12T/C481GACAACTCGTAACTTTCCACTCCTTAG
2064BF291774_6_B_2812811SBEREVERSE3102763.5137.044183.63T/C281GTAAGATCAACAAGGATCACCAAACAA
2065BF291774_6_B_3413411SBEFORWARD3142761.540.743189.06T/C341CAAACATCTGACACTCTGCTTCTTACT
2066BF291774_6_B_3633631SBEFORWARD3372664.9346.158378.55A/T363TACTGCAGGCAGTTAGCATTCTTCAC
2067BF291774_6_B_4084081SBEREVERSE4352564.12408374.31T/C408ACGACAATTCGAATGCTACTTGGAT
2068BF291774_6_D_48481SBEFORWARD212754.2525.934278.58G/C48TGATATTACACTATTACTCCTTTGTTT
2069BF291774_6_D_71711SBEREVERSE982564.09405270.85T/C71AAAGGAATAATGCCCAACAGAGTCA
2070BF291774_6_D_1501501SBEFORWARD1222860.2832.145390.63G/T150CGAGTAATTTGTTACAGTTTTCACACTT
2071BF291774_6_D_1501502SBEREVERSE1792763.1137.044286.49G/T150TTCAGTAAGATCAATAAGGACCACCAA
2072BF291774_6_D_1581581SBEFORWARD1312763.3837.045388T/C158TGTTACAGTTTTCACACTTGTTTGGTG
2073BF291774_6_D_1581582SBEREVERSE1872760.637.045294.67T/C158GATGTTCGTTCAGTAAGATCAATAAGG
2074BF291774_6_D_1641641SBEFORWARD1392564.92404166.06T/C164TTTTCACACTTGTTTGGTGGTCCTT
2075BF291974_6_A_2842841SBEREVERSE3112562.44405377.48T/C284TCCAAACAATAGTCGATGTTAAGGG
2076BF291974_6_B_95951SBEREVERSE1242761.140.744394.21G/C95GGTTTACTATCGGTAATCTGTGGATCT
2077BF292081_5_A_2832831SBEREVERSE3122758.337.044392.39A/T283AACTAGATTAGATAGAACTCTGCCACA
2078BF292081_5_B_1911911SBEFORWARD1642762.5137.046391.21G/C191ACGTCGCTGATCACTTGATATAGTTTT
2079BF292081_5_D_70701SBEREVERSE982661.2330.776388.38A/T70GTTTGTTGTTGACATTTCATTGTGAT
2080BF292081_5_D_2972971SBEREVERSE3262753.6833.336278.14T/C297CATAACAAACTAGATTAGGTAGAACTC
2081BF292295_3_A_33331SBEFORWARD72664.0438.463276.43T/C33ATACCTCACGAATGTGTTTTTCCCTT
2082BF292414_1_A_3043041SBEREVERSE3332754.6922.228282.39T/C304TTTCTTTAAAGCTCTTCTAATTTCTAT
2083BF292414_1_A_5155151SBEREVERSE5422563.77444372.86T/C515GACTCATTGTCGATATGGCTGAGAA
2084BF292596_3_A_4724721SBEFORWARD4462664.6538.464376.9T/C472ACGGCATCTATTATCAAGGGCATAAA
2085BF292596_3_A_5755751SBEREVERSE6032658.4734.628388.75G/C575AAGATGCCGATATATAGGGTATAACA
2086BF292596_3_A_6336331SBEREVERSE6622762.0237.044391.43A/C633AGAATCGACAAGATTGCATATAGGTTC
2087BF292596_3_D_1491491SBEREVERSE1762561.49324275.63T/C149CTCAATTTTTTCATTCAGACATCCA
2088BF292614_6_B_1891891SBEFORWARD1622763.2437.042183.18G/T189GTTTTCTGCTTTGTTGTGTATTTCTGG
2089BF292614_6_B_2602601SBEREVERSE2892758.0833.337291.96A/T260ATATACTCATTATAACCCATCTGTTCG
2090BF292614_6_B_3033031SBEREVERSE3322754.9233.334382.25T/C303CGTTACATTATACTCTTCGTTACTAGA
2091BF292614_6_B_3453451SBEFORWARD3182762.0640.744391.33T/C345AGTATAATGTAACGTCTCTTTGCCTGG
2092BF292614_6_B_3663661SBEREVERSE3932564.51408169.8G/T366GTTTGATTTCCAAATCCCATCTCCT
2093BF292614_6_B_4724721SBEFORWARD4452760.2233.334295.16A/C472ACATTAGACAATCGTATTCACAACAGA
2094BF292614_6_B_5135131SBEFORWARD4862760.0329.636297T/C513GTTTAAAATTCAGATAAATGGTGGAGA
2095BF292614_6_B_5855851SBEREVERSE6142763.7937.045386.75T/C585TAGGACCTGTATGGTTGTTTTGTTGAA
2096BF292614_6_B_6066061SBEFORWARD5812564.2404168.23A/T606AGGCCATTCAACAAAACAACCATAC
2097BF292614_6_B_6596591SBEFORWARD6332663.9438.464277.36T/C659ACAAGCATATTTGAAGAAGGGAAAGC
2098BF292614_6_B_6596592SBEREVERSE6882756.6529.634285.78T/C659TTACTTTGTAGTATGTATTCCTTTTCG
2099BF292614_6_B_6626621SBEREVERSE6912756.0929.634182.44T/C662TGGTTACTTTGTAGTATGTATTCCTTT
2100BF292614_6_B_6866861SBEFORWARD6592759.2233.333394.54T/C686AGCGAAAAGGAATACATACTACAAAGT
2101BF292614_6_B_7537531SBEFORWARD7262762.8637.044185.59T/C753ATAGTTACCAATCCAACCATATCAGCA
2102BF292614_6_B_7537532SBEREVERSE7812664.7746.157378.41T/C753TGGTAACCACCAGAGTTAACCCCTTA
2103BF292614_6_D_1061061SBEREVERSE1352760.7237.043293.04T/C106CAGCGAAAAGGAATACATACTACAAAG
2104BF292614_6_D_4074071SBEFORWARD3802763.5437.044386.87T/C407GTTACAAAGCTGTTCATGTGGTTTGAT
2105BF292614_6_D_6036031SBEREVERSE6312660.4534.622184.89A/C603GTTTTCTGCTTTGTTGTGTATTTCTG
2106BF293016_5_A_1581581SBEFORWARD1312763.6148.153386.06T/C158ATACTGTCTCCTGGCTCTACTCAAAGC
2107BF293016_5_D_2542541SBEREVERSE2822662.4442.315384.14T/C254CGGTCTCTGTTGATTCATTCAGTTAG
2108BF293133_3_A_67671SBEREVERSE952658.0134.621175.03T/C67AAGAAGAAGAAGAAAAACAGAGACAC
2109BF293133_3_A_68681SBEREVERSE952557.22321064.16T/C68AAGAAGAAGAAGAAAAACAGAGACA
2110BF293133_3_B_17171SBEREVERSE452663.0142.312177.23G/C17GAAGATGAAGCAGAGAAGAAGAATGG
2111BF293181_7_A_37371SBEREVERSE662761.537.043392.39T/C37GCTATTTCCTCTCTTGTTTACCTCAAA
2112BF293181_7_A_89891SBEFORWARD622764.1940.742282T/C89TAGCAGGTGAACGAGTGATTTAGCATA
2113BF293181_7_A_99991SBEFORWARD722762.4533.334390.16T/C99ACGAGTGATTTAGCATAGTGCAATTTT
2114BF293181_7_A_3323321SBEFORWARD3052763.9337.047285.91T/C332AAGTTTGTCAACTTGTTCAGCTTTGTG
2115BF293181_7_B_58581SBEFORWARD322664.1142.313276.22T/C58GAAATAGCAGGTGAATGAGTGGTTTG
2116BF293311_6_B_4104101SBEREVERSE4382661.4238.465285.54T/C410CATACGCACTACATTATGGAACTGAA
2117BF293311_6_B_4374371SBEFORWARD4112659.8938.465391.13T/C437CTTCAGTTCCATAATGTAGTGCGTAT
2118BF293371_7_D_6326321SBEFORWARD6052756.3622.225387.2A/C632AATATAATTTTTGTGTGCTTTCTCTTA
2119BF293371_7_D_6326322SBEREVERSE6592564.97444165.93A/C632ACGGCCACTGAGGGTAGAATAAAAA
2120BF293537_3_A_73731SBEFORWARD482563.22485375.12T/C73GACCAGGTAAAGCTCCACTCTTTGT
2121BF293537_3_A_73732SBEREVERSE1022763.2837.046388.9T/C73AGAGGAATCCAGGACATGTAACAAAAT
2122BF293537_3_A_2242241SBEREVERSE2532761.8648.154290.26G/C224GAAGTATAGGTGTCTGGGAGAGTGAAC
2123BF293537_3_A_2382381SBEREVERSE2672762.8640.744185.59T/C238AGCTTCGTTTTCAGGAAGTATAGGTGT
2124BF293541_4_A_88881SBEFORWARD612762.4233.334288.57A/C88TTTCTTCTTATGCTTGAATTACCGTGT
2125BF293573_4_B_2962961SBEREVERSE3232555.28247270.21T/C296AAATCTTATATTTTTACACAATCGC
2126BF293573_4_B_6666661SBEREVERSE6932563.45485171.1G/C666GGCTTCTAAAATAAGCTGGGTAGGG
2127BF293573_4_B_6676671SBEREVERSE6942563.45485272.77G/C667GGGCTTCTAAAATAAGCTGGGTAGG
2128BF293573_4_B_6686681SBEREVERSE6972764.344.445385.22T/C668GTTGGGCTTCTAAAATAAGCTGGGTAG
2129BF293573_4_B_6696691SBEREVERSE6972663.7342.315278.59A/C669GTTGGGCTTCTAAAATAAGCTGGGTA
2130BF293573_4_B_6706701SBEREVERSE6972563.84445271.62G/C670GTTGGGCTTCTAAAATAAGCTGGGT
2131BF293573_4_B_6736731SBEREVERSE7012664.5338.465377.87G/C673TTTGGTTGGGCTTCTAAAATAAGCTG
2132BF293573_4_B_6746741SBEFORWARD6492563.76528273.73G/C674GCTTCTAGAATAAGCTGCCCCCTAC
2133BF293620_5_A_72721SBEFORWARD452764.9440.744382.69T/C72CAGGTATCGAAAATTAAGCAGACGATG
2134BF293620_5_A_2462461SBEREVERSE2752760.5640.746295.4T/C246AAAGCTAGATACCTTGTCACTGCTATG
2135BF293620_5_A_3123121SBEFORWARD2852761.1640.745292.98A/C312TTCCAGGTAGTTACTTCTTCACCTTCT
2136BF293620_5_A_3123122SBEREVERSE3402663.8438.466278.9A/C312AATACCCTATGGTGGCAATTCAAGAT
2137BF294007_6_A_661SBEREVERSE342661.4246.156286.14G/C6GGTACATATGGGAGTCTGAAGAGTTG
2138BF428572_6_D_20201SBEREVERSE492762.2137.046392.12A/C20AGAGTTAAGAGGTTTGCTCAAAGGATT
2139BF428572_6_D_56561SBEREVERSE852757.1429.637390.79T/C56GTATAATACCGATTGTTTACAGCATAA
2140BF428572_6_D_2882881SBEREVERSE3152560.28366384.57T/C288GCTGTAAAAATCGAATTGGTGTAAG
2141BF428572_6_D_3053051SBEREVERSE3332664.5242.315276.24A/T305AACAGAAGGAGATTCTGGGCTGTAAA
2142BF428572_6_D_4154151SBEREVERSE4432664.4242.318176.74G/T415AGACGGATGAACATCCCTAGAAAGAA
2143BF428572_6_D_4314311SBEFORWARD4042757.0433.336389.86A/T431GGAACTAGAATATGATCAGCTAGAAAT
2144BF428572_6_D_4314312SBEREVERSE4592664.1242.314276.8A/T431ATCACTCCACCAGTAATCCACTGAAA
2145BF428701_6_A_1301301SBEREVERSE1592764.8940.746282.42T/C130GATTTTGTTTACTTCCATGGTCTGTCG
2146BF428701_6_A_1561561SBEFORWARD1302664.5242.316175.2A/T156GACGACAGACCATGGAAGTAAACAAA
2147BF428701_6_A_1561562SBEREVERSE1842664.338.464276.27A/T156AACATGAGTGGTTACTTTGGCATTTG
2148BF428701_6_B_2902901SBEREVERSE3192762.6129.636287.05A/T290TGCCATCAGCATTCTTATTTTTTATTC
2149BF428701_6_B_4474471SBEREVERSE4742564.64484268.59A/T447GGTACAGTCAGTCCTTCCCAACAAA
2150BF428701_6_B_5715711SBEFORWARD5442761.8733.336393.15T/C571TTTCAATTGCAGAATAGATACACTTGC
2151BF428701_6_B_5955951SBEFORWARD5702561.09405279.86A/T595CGAATGAACAACTTGGCTATTACAC
2152BF428701_6_B_5955952SBEREVERSE6242757.2625.934182.98A/T595CCTAAAATAGTGCCTAAGTAAAAAAAA
2153BF428701_6_D_2832831SBEFORWARD2562757.9433.336392.56T/C283AGCATATACAAAGCTTACTTCAGATTC
2154BF428701_6_D_5005001SBEREVERSE5272563.01407275.33T/C500CCATTTTAGGATTCAATACTTCGGC
2155BF428701_6_D_5415411SBEREVERSE5702760.9540.746395.89T/C541CCTTCTATAGCATTTTCTGTAGTGCTG
2156BF428701_6_D_6046041SBEREVERSE6312550.18204253.03T/C604TGTTTGTATTAACTTGTATTTGTAT
2157BF428701_6_D_9869861SBEFORWARD9612564.68484166.78A/T986AGGAGGACTCTCATCAACACTCCAA
2158BF428726_1_A_4204201SBEFORWARD3952561.8405379.39T/C420AAAATCCTCACTGAAGCTGATCTGT
2159BF428726_1_A_6686681SBEREVERSE6972753.0322.226377.83T/C668TATATTATGTAATTCCAATATGATGTC
2160BF428726_1_A_7467461SBEREVERSE7752759.4537.045396.48T/C746TGGATAATAGACATGACACGTAACTCT
2161BF428726_1_B_4124121SBEREVERSE4412764.4244.444384.23T/C412TCAGAGGCAGAGTTCTCAATTCCTTAG
2162BF428726_1_B_6766761SBEREVERSE7052758.529.635393.63T/C676ACTACAAAATGGATAATAGGCATGATA
2163BF428726_1_D_1761761SBEFORWARD1502664.2738.466277.61T/C176CTCAAGAATTCCAATATGATGTCCCA
2164BF428726_1_D_3033031SBEFORWARD2762760.7529.633188.32T/C303ACTAACCCCATAGAAACAGAAAAAAAA
2165BF428726_1_D_3033032SBEREVERSE3322764.3733.334282.73T/C303TAATCCTCCATTTTCAAGTGTTTTTGC
2166BF428726_1_D_3613611SBEREVERSE3902761.8733.333185.35T/C361CACTAACCCCATAGAAACAGAAAAAAA
2167BF428726_1_D_4884881SBEREVERSE5172764.1240.746183.06T/C488CTCTCAAGAATTCCAATATGATGTCCC
2168BF428792_2_A_3953951SBEFORWARD3702564.71405370.66T/C395CGAATGTCAATTCTTTCAGAGCCAT
2169BF428792_2_A_5305301SBEREVERSE5602858.3135.716387.02T/C530GCTCTAGAATCTTCCATACTTTAACACT
2170BF428792_2_A_6516511SBEREVERSE6802758.1733.336393.25T/C651GGATATCTTATTCACTACACACGATTT
2171BF428792_2_B_6276271SBEREVERSE6562763.2433.334286.12T/C627AATCAAACTGTGGAAAGTCAGCAAATA
2172BF428792_2_D_37371SBEREVERSE662758.0737.044290.05T/C37CATTCACTCTTCTATATTCTTACAGGG
2173BF428792_2_D_1061061SBEFORWARD792759.7737.046398.06A/C106ATATATCCCTGCACTAGAAGGTAAACA
2174BF428792_2_D_1061062SBEREVERSE1332561.19367382.46A/C106AGGAATTATTCATAAGCTTTGCTGC
2175BF428792_2_D_4174171SBEREVERSE4462759.4633.336295.45T/C417AAGATTCTAGAGCAAAGGAGAAACATA
2176BF428883_2_D_24241SBEREVERSE512561.35444278.46G/T24ATGAGCACTCTGTACTTGTCATGGT
2177BF428955_7_A_1571571SBEREVERSE1862762.4937.045289T/C157TCCTACTATGATTCTGCCAGTGTTTTT
2178BF428955_7_A_5085081SBEREVERSE5362662.9138.464280.43T/C508CAGATTTGCCCTTCCCTAAAATAAGT
2179BF428955_7_A_7287281SBEREVERSE7552563.55408376.02T/C728CTTTCTCATGAGCTGCTTTCATTTG
2180BF428955_7_B_4284281SBEFORWARD4012763.3633.336284.41T/C428TAGAAGGGCAGACCATTTAAAAAAAGA
2181BF428955_7_D_48481SBEREVERSE762662.2226.924282.51T/C48CAAAATTCAACAAAAACCGATTAACA
2182BF428955_7_D_1151151SBEREVERSE1442762.4940.744186.69A/T115AAGCACATGACAATGATACACACCTAC
2183BF428955_7_D_3293291SBEFORWARD3022764.3337.044384.5T/C329AGAAGGGCAGAGGATATTCATGTTTTT
2184BF428955_7_D_6556551SBEFORWARD6282760.0937.044397.23T/C655TGAGAAAGCTAGAGAAGCTATTTATCG
2185BF428955_7_D_6556552SBEREVERSE6842764.9540.743379.44T/C655GTAAAAAAAGGGGAGAAAGCAACCTCT
2186BF429045_1_B_2392391SBEFORWARD2132661.0946.156388.8T/C239CAAGTGACATGTGAAGTGTACCTACC
2187BF429057_6_A_4084081SBEFORWARD3832564.6523369.75T/C408GTCTTCTCATCTCCCACCTCAACAC
2188BF429186_1_B_1621621SBEREVERSE1892561.28446381.59T/C162GAGGCCTTCTCAAACCACTAGTAAA
2189BF429272_3_A_6176171SBEREVERSE6462754.9922.224382.48T/C617TTACAGTTCTATTGCATGATTATATTT
2190BF429272_3_A_7317311SBEREVERSE7602764.2533.334283.07G/T731TACAATCAATAATGTTCCAACCAACCA
2191BF429272_3_B_108610861SBEREVERSE11152759.1637.046294.57G/C1086ATACCTGAGCATGTAACCTATTCTTCT
2192BF429272_3_B_120212021SBEFORWARD11752761.729.634392.4T/C1202AATCCTTCTGTTAATTTTTCCCAACTT
2193BF429272_3_B_120212022SBEREVERSE12312754.722.228384.1T/C1202TTTTATCTTGCTCAAATATAAACTCTA
2194BF473056_1_B_53531SBEFORWARD272664.0842.316278.17T/C53CAAGATATTCTTCGTCGCATGGTTAG
2195BF473138_7_A_1291291SBEREVERSE1582762.2137.044289.21G/T129ACACTACAAAATACTGGTGCATCTTCA
2196BF473138_7_A_2062061SBEFORWARD1812562.93487377.24T/C206AGGTTTGGTAGAAACTACCTGGTGC
2197BF473138_7_A_2062062SBEREVERSE2352759.7833.334295.18T/C206AGTTAGACCACCGAATTTATGACTTTA
2198BF473138_7_A_2922921SBEREVERSE3212760.8833.336192.77T/C292TGGAGAAATGAATTAGTTTGGTCTATG
2199BF473138_7_A_4184181SBEREVERSE4472762.4237.044390.24T/C418TTATGAATATGGGCACGGAGTTTATAG
2200BF473138_7_A_4674671SBEFORWARD4422554.03245265.2G/C467CATAATTTAACTGAACCAAATAAGA
2201BF473138_7_A_4804801SBEFORWARD4542664.1938.462173.69T/C480GAACCAAATAAGACATCCACAACCAA
2202BF473138_7_A_4804802SBEREVERSE5072564.94405369.98T/C480TCCATGTGTTCAACTGAGAACCAAA
2203BF473138_7_B_1651651SBEFORWARD1382761.9137.046189.69T/C165CAAATTCATTTCTCCATCTAGCTTCTC
2204BF473138_7_B_1651652SBEREVERSE1942762.0637.044391.32T/C165GGTTCAATAGGCATTTATCTAGCTTCA
2205BF473138_7_D_94941SBEFORWARD672763.2644.448288.56T/C94GTTGTTGTATTCAACCTCAGTACCAGC
2206BF473138_7_D_94942SBEREVERSE1232762.140.746392.45T/C94CCGGATCTCAAGTTGTATACTCAAAGT
2207BF473138_7_D_1261261SBEREVERSE1552758.3729.635393.25A/T126CTACAAAATACTGGTGCATCTTTTAAT
2208BF473138_7_D_1611611SBEFORWARD1342759.237.044293.42T/C161AGATGCACCAGTATTTTGTAGTGTTAG
2209BF473138_7_D_1631631SBEFORWARD1362757.633.334390.31T/C163ATGCACCAGTATTTTGTAGTGTTAGTA
2210BF473138_7_D_2362361SBEFORWARD2112558.29324277.36T/C236TAAACTCATAAATTCGGTGGTCTAA
2211BF473138_7_D_2672671SBEFORWARD2412663.9334.628279.89T/C267ATTCTTGTTTTTCCATATGGCTGGTT
2212BF473138_7_D_3133131SBEFORWARD2862759.837.045397.53T/C313TTGGCTACACCCATAGACTAAACTAAT
2213BF473138_7_D_3133132SBEREVERSE3412664.6242.315275.94T/C313TTCACCGAGAAGCTAGATGGAGAAAT
2214BF473228_7_D_3063061SBEFORWARD2792758.0629.636189.58T/C306TTTCTGTTACTGATGAGTTTGTTATTG
2215BF473744_2_A_37371SBEREVERSE642564.8403267.47T/C37TTGGCTTTTGGTCTCATACATCACA
2216BF473744_2_A_2142141SBEFORWARD1872762.8529.632184.35T/C214TGTTCTGGGTTTATGTTGTTTTGATTT
2217BF473744_2_B_2112111SBEREVERSE2402761.2233.332189.25G/T211CATAGACAAAATCAAAGCAACATAACC
2218BF473744_2_D_1961961SBEFORWARD1692756.0622.224284.02T/C196ATATAAGGAAACATCAAATTAAGACAA
2219BF473744_2_D_4214211SBEFORWARD3952663.9338.465379.68A/T421ATTCCTACACCACTGATGCAAATCAT
2220BF473744_2_D_4214212SBEREVERSE4482563.68444373.11A/T421ATCAACTGCTGCGATGTAGTATTCG
2221BF473825_7_A_1781781SBEREVERSE2072756.3729.634284.96T/C178TATATGTAAACTTCAGGAGAAGAGAAA
2222BF473825_7_A_3923921SBEFORWARD3652762.640.746390.94A/C392GTTCTGACTAGGCATATTTTCAGTTGC
2223BF473825_7_B_2932931SBEFORWARD2672662.9738.464381.93T/C293GTTTTCTTCCATTTGCATGTACTGTG
2224BF473825_7_B_2932932SBEREVERSE3222761.0833.334394.26T/C293ACAACTTCAACAGAATGAGCAAATTAC
2225BF473825_7_D_50501SBEFORWARD232757.1229.635389.48T/C50ATATGAAAACAACTTCATGTCTATACG
2226BF473825_7_D_1781781SBEFORWARD1512759.937.044397.21G/T178ATCGAAGAAGACAATACTAAGCTCAAG
2227BF473825_7_D_1781782SBEREVERSE2072759.425.935396.31G/T178AACATTCAATCAAATAGTCAGATCAAA
2228BF473825_7_D_3283281SBEREVERSE3552562.75364274.26G/C328GTTGTGAATGAAATCTGCAATGATG
2229BF473884_7_A_3263261SBEFORWARD2992757.6837.046391.79T/C326CATATTAGCATGACTACTTGGTACTTG
2230BF473884_7_D_3243241SBEFORWARD2982660.4742.314389.41T/C324ACACTCCCTATCCATCTCTGGTATAA
2231BF474092_3_B_3133131SBEREVERSE3422758.1433.338292.74T/C313GTGAATAACACAAGTATTTTACACCCT
2232BF474092_3_B_3483481SBEFORWARD3212759.5833.335396.87T/C348TAAAATACTTGTGTTATTCACCACACC
2233BF474092_3_B_3483482SBEREVERSE3752564.63444370.27T/C348AGTATTTGGGAGCAACTGCAACAAC
2234BF474092_3_B_4144141SBEREVERSE4442854.73258275.84G/T414CATAGACAAGTATTTATCTTTATGTTCA
2235BF474139_1_A_2972971SBEFORWARD2722554.78286369.76A/C297TTCCTTACTAATACAATCAGGAAAT
2236BF474139_1_A_3423421SBEREVERSE3712759.7733.336398.05A/C342CAATAATTACCGCTATGTCATTGTCTA
2237BF474139_1_D_1981981SBEFORWARD1732551.57324257.2T/C198TAGGTATTTCTATCTCTGTCACTAA
2238BF474139_1_D_2212211SBEFORWARD1942755.7929.638387.37T/C221CTAATGCATTCATGTAGTTATGTAAAG
2239BF474284_1_B_3573571SBEFORWARD3312660.9238.464388.08T/C357CAATCTTTCCTGTTAGCTTCTGATTC
2240BF474284_1_B_3573572SBEREVERSE3862761.2525.936394.99T/C357TGATCATGCAAAGAGCAATAAAATAAT
2241BF474340_3_A_1341341SBEREVERSE1612564.67484370.16A/C134GGTGCATGTGAACTGGATAACCTCT
2242BF474379_7_A_2532531SBEREVERSE2812660.5334.626288.83A/T253TGAACATACATGGAGTATGATGACAA
2243BF474379_7_A_3923921SBEREVERSE4212759.9537.045296.32T/C392GTGTTAGAATATGATAGTGGGTCGAAT
2244BF474382_2_B_1061061SBEFORWARD792760.3337.045397.13T/C106ATTTAACCAAGTCTTATGCTCTGTCAC
2245BF474382_2_B_1061062SBEREVERSE1352761.5537.044291.19T/C106AACTAAACCAAGCTAACGAAGAACAAG
2246BF474382_2_B_1271271SBEFORWARD1002762.2240.744289.16T/C127TGTCACTACTTGTTCTTCGTTAGCTTG
2247BF474382_2_B_1611611SBEFORWARD1342759.3433.338296.36G/C161TATCATGATCATCTTCTTGGATAGGTA
2248BF474382_2_B_1771771SBEFORWARD1522563.9486373.73T/C177GGATAGGTACCAACGTTTTGGACAG
2249BF474382_2_B_2382381SBEFORWARD2132554.18365265.68T/C238GCTTGTACTCATACTCTACAAAGAA
2250BF474382_2_B_2722721SBEFORWARD2472563.45403271.53T/C272GACATCCATTTGTTCCACTTTAGCA
2251BF474382_2_B_2912911SBEFORWARD2652662.1242.317284.68T/C291TTTAGCAGCTATAAGTCTCCATCGTG
2252BF474382_2_B_3863861SBEREVERSE4152756.2125.936387.37A/T386AGAACTTAATTAGCTTTTTCTTTTAGC
2253BF474382_2_B_3883881SBEREVERSE4172757.3925.936390.91G/C388CCAGAACTTAATTAGCTTTTTCTTTTA
2254BF474382_2_B_4074071SBEFORWARD3802759.422.224395.71A/T407TGAAAAATGCTAAAAGAAAAAGCTAAT
2255BF474382_2_B_4074072SBEREVERSE4362755.2929.636384.62A/T407ATCATATCATAAAGTAGAACCAGAACT
2256BF474382_2_B_4104101SBEREVERSE4372552.12288261.37T/C410TATCATATCATAAAGTAGAACCAGA
2257BF474382_2_B_4234231SBEFORWARD3962756.5629.636286.78A/T423AAAAAGCTAATTAAGTTCTGGTTCTAC
2258BF474382_2_B_4374371SBEREVERSE4652661.4942.316387.61A/T437ACACATATCATCTCCATGGTCCTATC
2259BF474382_2_B_4634631SBEFORWARD4372660.3438.466391.07T/C463AAGATAGGACCATGGAGATGATATGT
2260BF474382_2_B_4654651SBEFORWARD4382762.2340.746392.05T/C465AGATAGGACCATGGAGATGATATGTGT
2261BF474382_2_B_4844841SBEREVERSE5132763.1640.744286.36T/C484ATACGACACATTAGGTTCCTGTAAGCA
2262BF474382_2_B_4934931SBEFORWARD4642951.4420.697360.37T/C493TGTTTATATAGTAGTATTATTTTGCTTAC
2263BF474382_2_B_4934932SBEREVERSE5202560.83406382.92T/C493CCAAATGATACGACACATTAGGTTC
2264BF474382_2_B_5095091SBEFORWARD4822761.9537.045392.27T/C509ATTTTGCTTACAGGAACCTAATGTGTC
2265BF474410_4_A_1591591SBEREVERSE1882764.6637.046384.78A/T159CTGGATAAATTGTTCAAGAGGCTGAAA
2266BF474565_7_B_8428421SBEFORWARD8152762.137.044289.52A/C842GGAAAACTGGATTTGATAGAGAGCATA
2267BF474565_7_B_8428422SBEREVERSE8712759.2633.333290.39A/C842GAGAAAAAAATGTAGTAATGAGAAGGC
2268BF474569_1_A_1501501SBEREVERSE1782663.5442.314380.21T/C150ACGAACATACGCATAAGGATCATAGC
2269BF474569_1_A_5385381SBEFORWARD5112762.633.337391.59A/C538GTTTTGTTAAACATTAGCCTGGATGAA
2270BF474569_1_A_8668661SBEREVERSE8952762.9333.336389.96T/C866TACAATTTTGGTTAACTGAGGGATCAA
2271BF474569_1_D_1501501SBEREVERSE1782663.5442.314380.21T/C150ACGAACATACGCATAAGGATCATAGC
2272BF474569_1_D_5385381SBEFORWARD5112762.633.337391.59A/C538GTTTTGTTAAACATTAGCCTGGATGAA
2273BF474569_1_D_8668661SBEREVERSE8952762.9333.336389.96T/C866TACAATTTTGGTTAACTGAGGGATCAA
2274BF474615_4_A_1011011SBEREVERSE1282564.8405370.39T/C101TCTTGGGCCATTCAACATAAACAGT
2275BF474615_4_A_3663661SBEFORWARD3392761.5237.046292.52T/C366ATTAATCTGGAGCTAAGTCAAAAGTGC
2276BF474615_4_A_3663662SBEREVERSE3942664.0438.463171.69T/C366AGATGAGGAAAAAAAACCTGAAGCAC
2277BF474615_4_A_3783781SBEREVERSE4072760.9129.635393.16G/T378ATAAATTAGCTCCAGATGAGGAAAAAA
2278BF474615_4_A_4334331SBEFORWARD4062763.5737.043182.84T/C433TTCATCTTAGGCTCTTGGTTGCTATTT
2279BF474615_4_D_1081081SBEFORWARD812757.5122.228392.53G/T108TGTTAATAATTTTAAGCACAATCATGT
2280BF474615_4_D_1231231SBEREVERSE1522763.9337.044284.03A/T123AACTCATTTTTCCAGATAAGAACAGCG
2281BF474615_4_D_1281281SBEREVERSE1572760.3733.334396.38T/C128GTCTGAACTCATTTTTCCAGATAAGAA
2282BF474615_4_D_1381381SBEREVERSE1672761.1129.637396.03T/C138TTAAATGCAAGTCTGAACTCATTTTTC
2283BF474615_4_D_2122121SBEREVERSE2392563.88403270.22T/C212AGATGGGAAAATAACCTGAACCACA
2284BF474615_4_D_2582581SBEFORWARD2312764.1837.044283.29T/C258TCCCATCTGGAGCTATTTTCTTGTTTA
2285BF474615_4_D_2902901SBEFORWARD2632764.940.743280.52T/C290TAACATTCTCTATGGTGTGGGTTGCTT
2286BF474615_4_D_3023021SBEFORWARD2772560.17364381.26G/C302GTGTGGGTTGCTTCTTTTTTATATG
2287BF474615_4_D_3873871SBEREVERSE4142564.52405269.56A/C387GCAAACTTTTTGAACACAGGGTCAT
2288BF474615_4_D_4534531SBEFORWARD4262759.1837.044395.04G/T453TATTTCTAGCCTGTTCTCTTCTTTAGG
2289BF474615_4_D_4534532SBEREVERSE4822760.8637.046396.17G/T453TAGATTGAATAACTGCAGGTCTCTTGT
2290BF474615_4_D_4684681SBEFORWARD4412763.1148.155287.13T/C468CTCTTCTTTAGGGTACAAGAGACCTGC
2291BF474615_4_D_4684682SBEREVERSE4972754.6525.938383.95T/C468CCTTAAAGATGTACATAGATTGAATAA
2292BF474615_4_D_5255251SBEFORWARD4982760.1237.045397.77T/C525ACCTTTTGAAGGCTCTAGTTAGTTTTC
2293BF474615_4_D_5585581SBEFORWARD5312758.2922.226291.97G/C558TATGCATGTTTTATTCTTTGTTATTGA
2294BF474615_4_D_5585582SBEREVERSE5852563.55363372.9G/C558GGTTGCTGAAATGTGAAGAAAACAA
2295BF474648_6_D_63631SBEFORWARD362761.2933.337395.51G/C63AGGATAACTGAAATCCTTGTTTTGAAG
2296BF474648_6_D_2122121SBEFORWARD1852764.3440.744384.49T/C212TATCCTCTCTCAAACCCAGACATGAAT
2297BF474648_6_D_2352351SBEREVERSE2642760.8833.334394.87G/T235AATGTTAATAGTGAGGGAAAAGCTCAT
2298BF474746_7_A_3153151SBEFORWARD2882759.1929.636396.32T/C315CTCTTTGGTGCTGTACATTTTTATTTA
2299BF474746_7_D_3883881SBEFORWARD3612758.2833.336291.94T/C388AAATACGTCTAGATACATCCATTTGAG
2300BF474746_7_D_3883882SBEREVERSE4172761.140.744394.21T/C388GTACTCCCTCCGATTCATATTACTTGT
2301BF474862_5_A_3313311SBEFORWARD3042761.4740.745393.7T/C331CTTGGTATGTATGCTGAATCTTAGACG
2302BF474862_5_A_3313312SBEREVERSE3602763.744.445285.36T/C331ACTACTCCCACGATTCCTAAATTACCC
2303BF474862_5_A_5365361SBEFORWARD5112561.66404277.53A/C536CGCTTCCAATATGTCAAACTCTGTA
2304BF474966_7_A_3413411SBEREVERSE3682563.03486274.65T/C341GTGTACTTCTTGAGAGGAACCGTGA
2305BF474966_7_D_20201SBEREVERSE492758.9833.336395.69A/T20CAAAGTACGCTAATTTACAACGTTAAG
2306BF474966_7_D_3763761SBEFORWARD3492758.7837.044393.85T/C376AAAGCTGTCTTCTGTAATTCCTAGTCT
2307BF475068_2_A_2712711SBEFORWARD2442760.829.635395.72A/C271AACCACCTTCATTCACTTTTTAAGTTT
2308BF475120_6_D_56561SBEREVERSE832559.05406382.56G/C56GACAAAATGTACTTGATGTAGTCCG
2309BF475149_1_D_99991SBEFORWARD742563.19484171.25T/C99GATTCGTTATCTGGGAAGTACAGGG
2310BF478387_1_A_7167161SBEFORWARD6902662.0938.463180.61T/C716CCCTTTGTTTTCTTTGAACTACACCT
2311BF478387_1_A_7167162SBEREVERSE7452760.2240.744295.17T/C716ACTAGAGCACAATACAGCCATATAACC
2312BF478387_1_B_1481481SBEREVERSE1772762.3237.045391.16T/C148ACACTATCGCCATTAAATCCTCTGTAA
2313BF478387_1_D_52521SBEFORWARD252760.8337.044293.33T/C52GCAAGTGCGATTCTGTTTATTTAGTAG
2314BF478387_1_D_2182181SBEFORWARD1902859.9532.146391.92G/C218TGAAGATTCATTATGGTTGTAGTAATCC
2315BF478387_1_D_2182182SBEREVERSE2472759.6333.333393.54G/C218GACCCATACTGATAAAGAAAAAACATC
2316BF478387_1_D_4474471SBEREVERSE4752664.3242.318380.38T/C447ACAAAGCAGTACTCTTCGATATGCCA
2317BF478690_1_A_6436431SBEFORWARD6162764.5740.744383.78T/C643CTGGAAATAATGATACTGGAAGGAGCA
2318BF478690_1_D_73731SBEREVERSE1022762.7725.936390.43T/C73TGATGAAATTGCAAAAACAGATGATTA
2319BF478690_1_D_2532531SBEFORWARD2262755.3329.634383.48T/C253TAGTGTATTTGTTTACTCATTTCAGTC
2320BF478716_5_A_3843841SBEREVERSE4132764.8233.336282.61G/C384AAGACCATTTGAAAATCCCGAAACTAA
2321BF478716_5_D_91911SBEREVERSE1182564.44486372.08T/C91AATAGAGCTATCCAACAGGCCACCT
2322BF478716_5_D_1131131SBEREVERSE1422759.8933.336296.76T/C113ATGTTGCTATCTCAACTTACCTTCAAT
2323BF478716_5_D_2172171SBEFORWARD1902764.0240.744283.77T/C217GTTTGAGGCAGGTTTCTTATATTGGTG
2324BF478716_5_D_2382381SBEREVERSE2672758.8637.043291.79T/C238CGTTACATCCTTACAGAGTTTTATCAG
2325BF478716_5_D_4284281SBEFORWARD4012760.0129.634295.79G/C428ATTAGCAATGAAGTTGTTTCTCTGTTT
2326BF478716_5_D_4314311SBEFORWARD4042763.1637.044388.03T/C431AGCAATGAAGTTGTTTCTCTGTTTCAC
2327BF478716_5_D_4684681SBEREVERSE4972761.2937.044393.64T/C468AAAATGCTACCTTAACGAGAACATAGG
2328BF478716_5_D_4714711SBEFORWARD4442757.5225.936391.3T/C471ATAATGATTTGGATAAAATGCTTACTC
2329BF478716_5_D_4804801SBEFORWARD4532759.8633.334397.08A/C480TGGATAAAATGCTTACTCCTATGTTCT
2330BF478716_5_D_4964961SBEFORWARD4692761.737.044392.4G/T496TCCTATGTTCTCGTTAAGGTAGCATTT
2331BF478716_5_D_4964962SBEREVERSE5252757.6129.634390.32G/T496ATAAATGAGAAGCTCCATAACATTAAC
2332BF478716_5_D_5165161SBEFORWARD4892761.5729.634392.79A/C516AGCATTTTTGTTAATGTTATGGAGCTT
2333BF478716_5_D_5355351SBEREVERSE5642763.7133.334284.72G/T535TGGCCCTGAATACCAAAAGAATATAAA
2334BF478737_1_A_4634631SBEREVERSE4902563.05444375.03T/C463ATGACAGTGGGAATTGTGCCTAGTA
2335BF478737_1_D_35351SBEFORWARD82763.4840.747287.28T/C35GTTCCCAGGGTACACAATCTGTTAAAT
2336BF478936_2_A_67671SBEREVERSE962760.1533.334397.04T/C67CCTGTTGATAAGAATGAATAAGTCGAT
2337BF478936_2_D_1351351SBEREVERSE1632664.5242.314377.28T/C135TTGGAAGAAGAACCTAGCCTGTTGAT
2338BF482269_4_A_2522521SBEREVERSE2812760.7337.044293.64T/C252GTTTGATTGGTTCTTATATTCCTCTCC
2339BF482269_4_B_5905901SBEFORWARD5652564.71406269.63A/T590ATTTCGAAGTGCGGCATGTATGTAT
2340BF482269_4_B_5905902SBEREVERSE6192759.3329.636396.75A/T590AGAAATATGTCACAACAATTAGTTCCA
2341BF482269_4_D_1711711SBEREVERSE1992664.9646.154375.96A/C171AATTCTACTCCCTCCGTCCCGTATTA
2342BF482356_4_B_5045041SBEFORWARD4772755.8425.935281.75A/C504ATTACTGTAGAAAAAATTGTGAAGAAC
2343BF482356_4_B_5045042SBEREVERSE5312559.65404281.45A/C504GTAAGCAACACAACAGGATTCTACA
2344BF482403_7_B_89891SBEFORWARD622764.1240.744385.13T/C89AAGCAGGTGCAAATCCATACTTACCTA
2345BF482403_7_B_2202201SBEFORWARD1952564.11445270.81G/C220TCTCACATTAGGTGGATGTTGCAGT
2346BF482403_7_D_1371371SBEFORWARD1102760.5433.336295.48T/C137AGATGTTGGTCAGCAATTGTAAAGTAT
2347BF482491_3_B_1981981SBEFORWARD1712764.637.043179.74T/C198TCTGAACTGTGTTTGGATTGTCTTTTG
2348BF482491_3_D_73731SBEFORWARD462761.3140.743392.95T/C73ATCAGTTTCTCTCGTCTTGGTTAGTCT
2349BF482491_3_D_1061061SBEFORWARD792763.8940.746387.09G/C106AGCTAGCATTAGCAGACGTCATTTTCT
2350BF482529_7_A_69691SBEFORWARD422760.7540.746294.84G/C69GAATATTACTCAATTACTCCCTCCGTC
2351BF482529_7_A_69692SBEREVERSE982758.9125.934394.24G/C69TTTATTCATTTTGGTGACAAGTATTTC
2352BF482529_7_A_1681681SBEFORWARD1412758.522.224393A/C168TTTATCCATTTTGATGACAAGTATTTT
2353BF482529_7_A_1681682SBEREVERSE1972762.9340.747187.27A/C168AGTTCATAAATTTGTACTCCCTCCGTC
2354BF482529_7_A_4014011SBEREVERSE4302760.6537.045396.16T/C401GACACTGTTTGAAGTAATTTGGAGAAC
2355BF482529_7_D_1611611SBEFORWARD1342761.6333.335187.69A/T161ACAGTGTCTTTTTTATAGCACCGATTT
2356BF482529_7_D_4894891SBEREVERSE5182764.4637.044384.13G/C489CATGTAAATATCAAAACGTGCATGGAG
2357BF482555_1_A_1421421SBEFORWARD1152760.0925.936398.48T/C142TTGAAAATGTGTCAAGTAAATGTTGAT
2358BF482566_6_A_6456451SBEFORWARD6202560.33364281.51A/T645AGTAAATGTGCTTCATGTCTTTGGT
2359BF482692_7_D_2092091SBEREVERSE2382761.1140.747294.37T/C209CGTATATAGTCCATATTGTGAACGGAG
2360BF482692_7_D_3033031SBEFORWARD2762761.0133.335395.08T/C303CATCCGATTTACAAAGAAGTTAGAACA
2361BF482692_7_D_3033032SBEREVERSE332275833.335392.11T/C303AAATACTCCCTCTGTTCACAAGTATAA
2362BF482781_7_D_5835831SBEFORWARD5552858.5132.144284.69T/C583TGATTTCTCTTGATATAACTATGTGAGC
2363BF482939_3_A_1911911SBEFORWARD1662560.55406383.77T/C191TTCATGACTACATGTTCGATGAGAG
2364BF482939_3_A_1911912SBEREVERSE2182563.34445171.43T/C191CAAGTGGCTCTCAGAAGAAGACAAA
2365BF482939_3_D_27271SBEFORWARD12663.1234.626382.71G/C27AATATGTTGGGGCACATTAATTTCAG
2366BF482939_3_D_27272SBEREVERSE552664.938.463375.5G/C27GAAACAAGCATCAAGCCAAAAAGTCT
2367BF482950_4_A_95951SBEFORWARD682758.9429.634190.98T/C95TGGGACCTTATTCTATATTTTCACTTT
2368BF482950_4_A_95952SBEREVERSE1242758.7529.636394.99T/C95TTACATGCAAATTCTAGTTATTGTCCT
2369BF482950_4_A_1991991SBEREVERSE2282760.9240.747294.94A/T199TACATAGATCATCCTTGTCCCAGTTAG
2370BF482950_4_A_2722721SBEREVERSE3012763.4929.634282.76A/T272TGCCTTTCTCCCTTTAATTCTTTTTTT
2371BF482950_4_D_1041041SBEFORWARD782663.3346.156178.76T/C104ACATATATACTCCTGGCATGGTGGTC
2372BF482950_4_D_2352351SBEFORWARD2072859.7132.147391.85T/C235GCTTAAGAGTTATTAACAAGACGATCAA
2373BF482950_4_D_2352352SBEREVERSE2632664.3938.465378.28T/C235AATTAACGTATCCAATGGCTGAAAGC
2374BF482960_4_B_75751SBEFORWARD492664.53504377.25T/C75CTCTCCAGGTTATCGTTATCTCCTGC
2375BF482960_4_B_1651651SBEFORWARD1382758.5933.334189.94T/C165TTATGTGATTACTCCTGTTATTGTCCT
2376BF482960_4_B_1811811SBEFORWARD1542761.1337.044292.44T/C181GTTATTGTCCTGCATATTACACCTTTG
2377BF482960_4_B_1811812SBEREVERSE2102761.8337.044392T/C181GAGTTTAGAGCAAAATGGAAGACATTC
2378BF482960_4_B_6676671SBEFORWARD6412660.8846.155185.49G/C667GTTAGCCTAGTCCACTGTTCATTCTC
2379BF482960_4_B_6676672SBEREVERSE6962751.8625.936374.34G/C667TCACTAGTAGAATGTAAGAAATAAGTT
2380BF482960_4_B_8028021SBEFORWARD7752762.5948.158290.55T/C802GCAGTACTCCATGTAGTCGTTACTTCC
2381BF482960_4_B_8028022SBEREVERSE8312757.6833.335289.51T/C802GTGATTCAATAGGTAAGGAGTAGAAAA
2382BF482960_4_B_8408401SBEFORWARD8142660.4538.465390.1A/T840CTTACCTATTGAATCACCAAATAGCC
2383BF482960_4_B_8788781SBEFORWARD8522664.44506378.77G/T878ACTAACAGATACTCGAGGCCCCTACA
2384BF482960_4_B_8788782SBEREVERSE9072757.6522.225391.08G/T878AAGCAAATAAACTAAACTTGAAGAAAA
2385BF482960_4_D_6296291SBEFORWARD6022757.9233.335290.21T/C629TCTCCTAACTTATTTCTTACATTCTGC
2386BF482960_4_D_7317311SBEFORWARD7062562.99486376.46T/C731GCAGTGCTCCATGTAGTCGTTACTT
2387BF482960_4_D_7317312SBEREVERSE7592657.5334.625282.37T/C731ATTCAATAGGTACGGAGTAGAAAATC
2388BF482960_4_D_8338331SBEFORWARD8082555.41285269.34T/C833CAGATTTTCTTCAAGTTTAGTTTGT
2389BF482977_3_B_2892891SBEREVERSE3182763.4944.445387.64G/C289GAACTTAGTCAAGGAGTGGCTTCATCT
2390BF483025_6_D_2252251SBEREVERSE2532661.8842.317285.4T/C225CACTGGAGTATTATGCCACAGTTTCT
2391BF483039_7_A_3463461SBEFORWARD3202664.8346.152273.43T/C346GAGGAAGGTCAACAAACAGGGATAGA
2392BF483039_7_A_3463462SBEREVERSE3742664.6238.463173.02T/C346ATGATGGTTGTTTACCTTGTGGGATT
2393BF483091_6_A_2242241SBEFORWARD1972763.2937.048288.46A/C224TTTCTTTTAGAAAACAAGGCTAGGCAG
2394BF483091_6_A_2502501SBEREVERSE2772564.82402266.78T/C250TGGTGCTGTTGCTTGTTTGTTGTAT
2395BF483091_6_A_3413411SBEFORWARD3142760.6725.934395.48G/T341TTTTAGAAACCATTCAAGAAAACAGAA
2396BF483091_6_A_3413412SBEREVERSE3712858.0128.574382.73G/T341GGTAGTAAAAAATTAAACTGGACAAACT
2397BF483091_6_A_5345341SBEFORWARD5092556.84447376.57T/C534GCACAGTGTGTCTAAGTACTGATCT
2398BF483091_6_D_1771771SBEFORWARD1512664.9642.314274.29A/T177TATACAAGGCAGTGAGGCATAGCAAA
2399BF483091_6_D_1771772SBEREVERSE2042564.56443268.19A/T177CAAACTATTGCTCAGGGGTGCTAAA
2400BF483091_6_D_3153151SBEFORWARD2882762.1933.334187.6T/C315ACAAACTTCTTCTGTTTTCTTGAATGG
2401BF483091_6_D_3153152SBEREVERSE3422563.43402270.97T/C315GTAGTTTGTGCTTTTCCTTTTTCGC
2402BF483091_6_D_4064061SBEREVERSE4342664.7546.154173.24G/T406TAGAAAACAAGGCTAGGCAGATACGG
2403BF483091_6_D_4414411SBEREVERSE4702761.7733.334392.2T/C441TTTTAAGCTGTGATACCAACATTTCAG
2404BF483227_5_A_1261261SBEFORWARD992762.3833.334288.68G/T126TTTGGGTGTTTTCTCTGTTCTACAAAT
2405BF483227_5_A_1261262SBEREVERSE1552760.8233.333394.41G/T126GAGTTGAAAGAAGAAGGAAAGTGTTTT
2406BF483227_5_A_3683681SBEREVERSE3972757.733.334288.95T/C368ATCTGAGGATAAAAGTACGAACATAAG
2407BF483227_5_D_81811SBEFORWARD562561.6325176.67T/C81CTGAAGCAATCGTAACAAATGAAAA
2408BF483299_3_A_58581SBEFORWARD302859.5139.295389.99T/C58CACTGACTATCTACTTGAAGAACACTGA
2409BF483299_3_A_77771SBEREVERSE1062764.0940.747387.1G/T77CAGATGCAGAGGGTTTAATAAATAGCG
2410BF483299_3_A_87871SBEFORWARD602757.3329.634287.82T/C87AATACAAGGTACTATTTGACGCTATTT
2411BF483299_3_A_94941SBEREVERSE1222661.8638.467387.13T/C94CATAGATAGGAATTTCCAGATGCAGA
2412BF483299_3_A_1011011SBEFORWARD742763.6537.047286.75A/T101TTTGACGCTATTTATTAAACCCTCTGC
2413BF483299_3_A_1151151SBEREVERSE1442762.0933.338391.5T/C115TTTCCTGATCTGAAAAAAGGTTCATAG
2414BF483299_3_A_1341341SBEREVERSE1632761.6840.744290.8T/C134TGAAGTAGACACCTACAAGTTTCCTGA
2415BF483299_3_A_1371371SBEREVERSE1662760.7144.445395.98T/C137GTGTGAAGTAGACACCTACAAGTTTCC
2416BF483299_3_A_1611611SBEFORWARD1342759.5940.744294.6T/C161GATCAGGAAACTTGTAGGTGTCTACTT
2417BF483299_3_A_1611612SBEREVERSE1902756.129.634385.8T/C161TAATAACAAGAAAGTACAGATGTTGTG
2418BF483299_3_A_1621621SBEFORWARD1352759.5940.744396.27T/C162ATCAGGAAACTTGTAGGTGTCTACTTC
2419BF483299_3_A_1631631SBEFORWARD1362761.6840.744392.47T/C163TCAGGAAACTTGTAGGTGTCTACTTCA
2420BF483299_3_A_1631632SBEREVERSE1922754.6729.634381.5T/C163AGTAATAACAAGAAAGTACAGATGTTG
2421BF483299_3_A_1651651SBEFORWARD1382760.8240.744395.04T/C165AGGAAACTTGTAGGTGTCTACTTCACA
2422BF483299_3_A_1971971SBEFORWARD1702756.229.634284.44G/T197TCTGTACTTTCTTGTTATTACTTCCAT
2423BF483299_3_A_2342341SBEFORWARD2072760.3529.634294.79G/C234TTGGCATTGTGAATTTATCTTACCTAT
2424BF483299_3_A_2402401SBEFORWARD2132758.2633.334290.62T/C240TTGTGAATTTATCTTACCTATCCAGTC
2425BF483299_3_B_45451SBEREVERSE742760.7144.445395.98T/C45GTGTGAAGTAGACACCTACAAGTTTCC
2426BF483299_3_B_54541SBEREVERSE832760.4240.745396.87T/C54ACAGATGTTGTGTGAAGTAGACACCTA
2427BF483299_3_B_60601SBEFORWARD332761.8337.048188.96T/C60CTTTTTTCAGATCAGGAAACTTGTAGG
2428BF483299_3_B_60602SBEREVERSE892758.1137.044188.49T/C60GAAAGTACAGATGTTGTGTGAAGTAGA
2429BF483299_3_B_61611SBEFORWARD342761.7333.338290.91T/C61TTTTTTCAGATCAGGAAACTTGTAGGT
2430BF483299_3_B_61612SBEREVERSE902757.3737.044287.96T/C61AGAAAGTACAGATGTTGTGTGAAGTAG
2431BF483299_3_B_72721SBEFORWARD452760.8244.444395.04T/C72CAGGAAACTTGTAGGTGTCTACTTCAC
2432BF483299_3_B_76761SBEREVERSE1062858.4732.144182.92T/C76CATGGAAGTAATAACAAGAAAGTACAGA
2433BF483299_3_B_86861SBEFORWARD592757.9840.745392.08T/C86GTGTCTACTTCACACAACATCTGTACT
2434BF483299_3_B_86862SBEREVERSE1152758.6933.336293.14T/C86GTGAGATTTCATGGAAGTAATAACAAG
2435BF483299_3_B_1421421SBEFORWARD1152760.3529.634294.79G/C142TTGGCATTGTGAATTTATCTTACCTAT
2436BF483299_3_D_1131131SBEFORWARD872658.2834.626386.92A/T113TAACTGACAACTTTGAACAGCTTAAC
2437BF483405_4_A_13131SBEREVERSE422762.2637.045391.34T/C13TCGATCTCACTTACATTCAATCTGGTA
2438BF483487_5_D_1841841SBEFORWARD1582664.8246.154274.7G/C184AAGGGGTAAGTCTGGTTTGTTCCTTC
2439BF483487_5_D_3883881SBEREVERSE4152562.07444276.29G/T388CAGCGATCCTTGTCGTTAATACTCT
2440BF483498_3_D_1241241SBEFORWARD972759.4533.337397.73T/C124ATGTGTATGTACAATGTAGGGAAAATG
2441BF483498_3_D_1291291SBEFORWARD1022758.0329.637291.78T/C129TATGTACAATGTAGGGAAAATGTATGA
2442BF483498_3_D_3923921SBEREVERSE4212755.5837.046385.49T/C392CTATAAGGTACCAATAAGATCAGTAGC
2443BF483498_3_D_4104101SBEFORWARD3832758.0637.046392.92T/C410TGTACACTATGGCTACTGATCTTATTG
2444BF483498_3_D_4104102SBEREVERSE4392756.8633.337288.28T/C410TCAACAAGTTGTCTATCACTATAAGGT
2445BF483498_3_D_7017011SBEREVERSE7302756.9133.338187.4G/C701ATAATTGTATAATTGCTACCCTCTCTC
2446BF483498_3_D_7607601SBEFORWARD7342663.7338.466279.24G/T760GTCTTGCATTCAACTATTCATGCCTT
2447BF483498_3_D_7607602SBEREVERSE7892761.8633.334188.58G/T760GAATATAACCGAAGAAACCAAACAGAA
2448BF483551_4_A_4304301SBEFORWARD4032761.9437.046291.27T/C430ATCAGTTTTATCATGTTGAAGGCTACC
2449BF483551_4_B_2772771SBEFORWARD2502764.940.747384.67A/T277TCATGGTAAGACTACCAAGGATTGCAT
2450BF483551_4_B_2772772SBEREVERSE3042564.94446268.92A/T277GGACTTGTCCAAAGAGCTGATGAAA
2451BF483640_4_B_41411SBEFORWARD162558.06324276.68T/C41AATTCATCCATCCAAGTATCAACTA
2452BF483640_4_B_3303301SBEFORWARD3032760.8333.335395.65T/C330TTCCTTGGATATGATTTAGCCTAGTTT
2453BF483640_4_B_3303302SBEREVERSE3582664.138.465175.82T/C330ATATAATACCATGCAAAAGGGCGAAC
2454BF483993_6_D_1981981SBEFORWARD1712762.4237.044286.35T/C198CTTTTTTATATTTACGAACGGAGGGAG
2455BF483993_6_D_2592591SBEREVERSE2882764.0833.334283.61T/C259TGAACAAATGAGAATGCTGGAAGAATA
2456BF484028_5_B_1061061SBEFORWARD792751.829.634372.9T/C106TAGCTTATTGAGTATTAACTTCTAGTC
2457BF484028_5_D_2142141SBEREVERSE2432761.0840.748396.76T/C214GAGTGTAGATAGCTCAATCTGCAAAAG
2458BF484028_5_D_4124121SBEREVERSE4412762.1937.044289.26G/C412TGTGAAGGAACAAACTTAAAAGAGGTC
2459BF484270_2_B_97971SBEFORWARD702764.1751.856386.25T/C97CTTCTAGTTCTAGGGTTCTAGCGCCTC
2460BF484270_2_D_3173171SBEFORWARD2902760.1829.634295.3T/C317ATGCTTCAAATTACATAAAAGAACTGG
2461BF484270_2_D_3173172SBEREVERSE3462756.5133.334387.04T/C317ATATAAACACAGCATAAGGTACATAGC
2462BF484270_2_D_3263261SBEREVERSE3552759.1933.334293.39A/T326AGTTCGACAATATAAACACAGCATAAG
2463BF484270_2_D_4444441SBEREVERSE4732764.5633.335282.78T/C444TTTGTTTCCAAGTTGTCAAATACACCA
2464BF484342_7_A_3003001SBEFORWARD2742662.8738.466383.48T/C300GCACAGTTGTGGATATTGATTTGTTC
2465BF484342_7_A_3003002SBEREVERSE3292759.1329.637295.11T/C300ATCAATATCAGCCAGATAAAGAAAACT
2466BF484342_7_A_3573571SBEREVERSE3862764.1940.744181.59T/C357CTGATGTATGACCACATAACCCTTTGA
2467BF484585_4_A_2272271SBEFORWARD2002762.2237.045391.47T/C227AGTTACCAACTAATCCTATTGATGCCA
2468BF484585_4_B_2132131SBEFORWARD1862762.0629.632184.5G/T213TTTTATTGTTTGCCTCTTTTTTCTGTC
2469BF484585_4_D_2272271SBEFORWARD2002762.0240.746291.02G/T227AACTGTTCACGAGTTACCAACTAATCC
2470BF484585_4_D_4824821SBEFORWARD4572559.17405382.32T/C482ACATGCTTAGGAAGTTAGGATGTTC
2471BF484585_4_D_5455451SBEFORWARD5182759.7829.636398.1G/T545TTCTGTGTAAATCAACACCTTTTATTG
2472BF484585_4_D_5455452SBEREVERSE5742764.4737.045384.72G/T545TGTATTTGATTCCAAAGTCCTGGAAAG
2473BF484585_4_D_5935931SBEREVERSE6222764.9248.156282.32T/C593AGATCTTATCGGTAACAGACTCAGGGG
2474BF484606_1_A_38381SBEFORWARD112758.8533.338193.22A/T38ATTTGTTTAAAGAGATCCCAAGTAGAG
2475BF484606_1_A_52521SBEFORWARD252763.144.445388.82T/C52ATCCCAAGTAGAGTCAAAGCTCTAGGA
2476BF484606_1_A_52522SBEREVERSE812763.0537.043286.06T/C52TAAACAATCCAGCCTACCAAAGTTACA
2477BF484606_1_A_2502501SBEFORWARD2232761.6729.634392.48G/T250TCTTTTTCTTTCAGATACCGAACAAAT
2478BF484606_1_A_2502502SBEREVERSE2792754.2229.636381.4G/T250TTATCAAGTATACATTACTCCTCAAGT
2479BF484656_1_D_4724721SBEREVERSE5002663.5234.626381.51T/C472AACTTAATTGTGCAAAAGCATCATCC
2480BF484656_1_D_5065061SBEREVERSE5352758.5933.334393.27G/C506ATGATAGTCCACACCATAAAAAGTAGA
2481BF484656_1_D_5295291SBEFORWARD5042559.83403281.37A/T529TCCTTCTACTTTTTATGGTGTGGAC
2482BF484958_3_B_72721SBEREVERSE1012754.4829.634380.95T/C72TGTAATAGTGATAAATAGGATCTGTTC
2483BF485078_4_A_3053051SBEFORWARD2802564.52446371.86T/C305TTGGAGCAGGTACTGCAAGAACTTT
2484BF485078_4_B_99991SBEREVERSE1282758.1925.937393.94A/T99ATTACAGAAATGAAGTTCAGAAAGAAA
2485BF485078_4_B_1401401SBEFORWARD1132764.5937.047283.94T/C140CTTCATTTCTGTAATCAAACCATCGCT
2486BF485078_4_B_1401402SBEREVERSE1692762.1329.634289.44T/C140ATTACGTTTGATTTGTTCTGGTTTCAT
2487BF485168_1_B_4284281SBEFORWARD4022664.2638.463377.42G/T428TTTCGCTCTTCTTTTAGGTGGGAATA
2488BF485168_1_B_7857851SBEFORWARD7582760.5629.634294.16T/C785TCTTGATAAAATTGTTCCTGATATGCT
2489BF485305_1_D_29291SBEREVERSE582761.1540.744394.05T/C29TATAGGGATGTGGTTAGGACAGTACAA
2490BF485380_7_B_4794791SBEFORWARD4532655.3734.628379.44T/C479AAGTACCTCTAGAATTGCTTACTTTC
2491BF485399_4_A_1721721SBEFORWARD1462664.7126.926374.88T/C172ATCTTGCGAAATTTTGGGTTTTTTTT
2492BF485399_4_B_2542541SBEREVERSE2812564.79404366.59G/T254ACTCGTTCTGCAAGGGAAAAAAAAC
2493BG262287_7_B_5685681SBEFORWARD5402858.1528.576386.52T/C568TGTAACTAAGAAGATTCTCACATGTTTT
2494BG262287_7_B_5685682SBEREVERSE5972762.744.446390.66T/C568CTCATAAACTGCATACAGCAGAGACAG
2495BG262734_3_A_2852851SBEREVERSE3142761.1233.333393.5T/C285GGAACAATAAATAATCAGCAGCCTAAT
2496BG262734_3_A_3073071SBEFORWARD2822564.82403267.42T/C307TGCGGATTAGGCTGCTGATTATTTA
2497BG262734_3_A_6496491SBEREVERSE6762560.68368384.64T/C649CTGATGTTCAATTGTTCATTCACAC
2498BG262734_3_D_67671SBEFORWARD422557.25366377.16G/C67TAGTTCACTGTTGACACTGTTCTTT
2499BG262734_3_D_2302301SBEFORWARD2032758.2740.745392.93G/C230GAGTAGGGACTGACTACAACACATAAT
2500BG262734_3_D_3793791SBEFORWARD3522762.4640.747290.32T/C379TGGTAACCAGAGTCCAGAGTACAAAAT
2501BG262734_3_D_3793792SBEREVERSE4082761.6229.635390.67T/C379ATGAGAACTTTTTTTCCTGATGAATGT
2502BG262882_1_B_77771SBEFORWARD502754.2629.638382.77T/C77TAGATACAGTACTTATGGGGTAAAATA
2503BG262960_7_A_4474471SBEREVERSE4762761.9533.334188.32G/C447GTTTATTGATCCCCTTTGTAATTTGTG
2504BG262960_7_A_4654651SBEREVERSE4942763.3844.446286.93T/C465AGTACTACCTCCGTCCTGGTTTATTGA
2505BG263028_1_B_25251SBEREVERSE542759.4929.637397.85T/C25AGAAAATTTCAAACCTGTGCTATTAAC
2506BG263028_1_B_1821821SBEREVERSE2112763.4640.745387.75T/C182AAACACAGACCAATCTGACTGCATACT
2507BG263076_5_B_1941941SBEREVERSE2263054.16205360.61T/C194GATGAAAACTATAATAAAGAAACTAATGTA
2508BG263076_5_B_2162161SBEFORWARD1863053.73205359.31A/T216CAGCTATTATTACATTAGTTTCTTTATTAT
2509BG263076_5_B_2162162SBEREVERSE2452760.2129.636398.13A/T216AACATGAATGAGTGTAACTGATGAAAA
2510BG263076_5_D_1531531SBEREVERSE1822758.1525.936393.19T/C153AGTTCGAATGTAAAGTCAAAGATTAAA
2511BG263076_5_D_1981981SBEREVERSE2272761.0437.044394.37T/C198GACATATTTGAAGGAATGTGGTGTAAC
2512BG263213_4_B_1171171SBEFORWARD902764.2748.156182.62T/C117ATCGTTTGCTTAGCTACTACTCCCTCC
2513BG263213_4_B_2482481SBEFORWARD2212764.5344.444282.23T/C248GTATTTTGGGATGGAGGGAGTACAAGT
2514BG263213_4_B_2802801SBEFORWARD2542656.0934.628279.94T/C280AGAGATATCACTATGAACCACATACA
2515BG263213_4_B_3123121SBEFORWARD2852753.625.936379.55T/C312ATATAGATGCATTTTAGAGTGTAGATT
2516BG263213_4_B_3123122SBEREVERSE3412757.3633.337289.8T/C312TATGGACTACATACAGAGCAAAATAAG
2517BG263213_4_B_3483481SBEFORWARD3212759.5737.047398.08T/C348TGCTCTGTATGTAGTCCATAGTTGAAT
2518BG263213_4_B_3503501SBEFORWARD3222859.535.717391.22G/C350GCTCTGTATGTAGTCCATAGTTGAATTT
2519BG263213_4_D_21211SBEREVERSE492664.138.464276.86A/T21AAACCCAACATTAACCTCTCGCTAAA
2520BG263233_1_D_3973971SBEREVERSE4242554.75284266.76T/C397AGTATCAACTGAATTTTTGTACCTT
2521BG263233_1_D_3993991SBEREVERSE4282760.2233.334396.85T/C399AGCAAGTATCAACTGAATTTTTGTACC
2522BG263233_1_D_6326321SBEREVERSE6612762.7640.744185.87T/C632TATCCACGTTGTTCTTCTATGCTCTCT
2523BG263233_1_D_6816811SBEFORWARD6542764.8537.046280.31A/T681GTGGATAAAAAACTGATCAAAGCAACG
2524BG263266_7_A_59591SBEREVERSE882756.9733.338390.9T/C59CAATGATCATAACAGATAAGAACTAGC
2525BG263319_7_B_1141141SBEFORWARD882659.538.465288.3A/T114ATATCTACTTGTGGTGTTGGATATGG
2526BG263319_7_B_1421421SBEREVERSE1692559.26327383.81A/C142ATACACAAGATTCTTTGGTGGAAAT
2527BG263319_7_B_1511511SBEFORWARD1242764.2340.746386.07T/C151AGTGGCCTCTCAAGTGTTATATTTCCA
2528BG263358_1_A_51511SBEREVERSE782563.66484271.51T/C51CGTGGTACGAAACCGTAGTTATGTG
2529BG263358_1_A_1571571SBEFORWARD1302758.8825.936395.38A/T157AGTTTTGCATTACTGATTTCAAGTTTA
2530BG263358_1_A_1881881SBEREVERSE2172761.9637.044391.63T/C188TCAGAACACATAAGACATTCTCGATTC
2531BG263358_1_D_1711711SBEFORWARD1442764.8544.444382.96T/C171ATAAGACATTCTCGGACACCTTGTGAG
2532BG263358_1_D_3523521SBEFORWARD3262661.6230.778388.46G/T352CTTAATTTTCATGCATGTTCTCCATT
2533BG263358_1_D_3663661SBEREVERSE3952763.9937.044182.2T/C366TGGTGGTGTATGACAAGAAAGCTAAAA
2534BG263521_2_A_1881881SBEREVERSE2172761.9737.044289.93T/C188AGTAAAACAATTTCCAACTAGCCACAC
2535BG263521_2_D_3293291SBEFORWARD3032660.5842.318289.93T/C329CTAAGGCATGCTTATAGTAATGGGTC
2536BG263563_4_B_2662661SBEFORWARD2392759.7837.046398.08T/C266CTTGTCTTATAAACCATCTAAACCAGG
2537BG263601_4_A_50501SBEREVERSE792755.8729.637386.98T/C50TACTGAAACTGAGTTATAAACTTGACA
2538BG263601_4_A_76761SBEREVERSE1032563.51404373.65T/C76GGGAGTTTACTGAATGTGCCAAAAT
2539BG263601_4_A_1441441SBEFORWARD1172764.4233.338285.09T/C144TTATTTTCTTTAAAGCTTTTGACCCCG
2540BG263601_4_A_6026021SBEFORWARD5752758.3929.638395.18A/T602ATGATCATATGGTCCTCAGATAAAATA
2541BG263601_4_A_6026022SBEREVERSE6292562.33444275.52A/T602GAACCTGGCAATTACAACATCTCTC
2542BG263758_3_B_2752751SBEFORWARD2502560.19327283.82T/C275CAACATAATTTTGAAACAGACACCA
2543BG263769_3_A_55551SBEREVERSE842759.5129.634396.02T/C55ACTCTAATAACTTCTCGCAAAAGAAAA
2544BG274119_1_A_2212211SBEFORWARD1942762.937.044287.12T/C221GAGAAGGTTCCATTTCTGTCCATTTAT
2545BG274119_1_A_2212212SBEREVERSE2502762.829.636390.36T/C221TGAAAATATGCATTTGAACAAGTACGA
2546BG274119_1_A_3673671SBEREVERSE3962764.3640.744384.41T/C367AATGGACTGAAACCAGCTACAATCACT
2547BG274294_1_B_3483481SBEREVERSE3752564.65486269.81T/C348CCACGTGAGGGTCTTATGTTCAGAT
2548BG274294_1_B_4654651SBEREVERSE4942759.7937.044396.88T/C465TCTATATGTTTCCACCTGTACTTTGTG
2549BG274365_2_D_5525521SBEFORWARD5252760.2337.047398.7G/T552CTTGGGTTTCATACAGTATTTAGTGCT
2550BG274398_6_B_3843841SBEREVERSE4112563.05444273.36T/C384GAGTGATGGAGCTTGTCGTTTTAGA
2551BG274398_6_B_6366361SBEREVERSE6652764.0133.338286.32G/T636AGCATTGATTGGCCATTCTCTTATTTA
2552BG274508_6_A_29291SBEREVERSE582754.4125.934177.4T/C29ATAACATAATAACATGACCAATAGAAG
2553BG274508_6_D_1991991SBEREVERSE2282757.4129.634288.06T/C199TAACATAATAACATGACCAACAGAAGT
2554BG274556_3_B_2552551SBEREVERSE2832660.4630.774389.46T/C255TATTGAAAACATCGGCACAAATATAG
2555BG274576_7_D_31311SBEFORWARD42762.2637.046391.97T/C31AAGCTATTTACGTACGGATCACACAAT
2556BG274584_2_A_4564561SBEFORWARD4312563.16448377.17A/T456AACACCAAAGTACTATGCAGTCCGA
2557BG274584_2_A_4954951SBEFORWARD4682760.5425.936193.81T/C495TTATAAAACATCAACAAAAACCCATTC
2558BG274584_2_A_4954952SBEREVERSE5232657.5234.627283.6T/C495ATCTACATCAGACAGATGACAGTTTT
2559BG274584_2_A_6276271SBEREVERSE6552660.1138.468393.01T/C627GAGCAACTAGTTCATAGCAATCATGT
2560BG274584_2_B_5675671SBEFORWARD5402761.3837.046394.62T/C567TAATATGCTTCTGCTGAACTTTCTGTC
2561BG274853_7_D_4694691SBEREVERSE4982758.7833.334393.84T/C469GTTCTAACAGGTTCCAAGTTTTAAGAT
2562BG274948_5_D_4344341SBEREVERSE4622660.1230.774288.8A/T434GTTTTATGGGTAAATCGAAGAAAAGA
2563BG274948_5_D_4454451SBEFORWARD4182761.1433.338396.58T/C445AAGGTCAGTACTGCAATTTCTTTTCTT
2564BG274948_5_D_4924921SBEREVERSE5212760.8240.746396.29T/C492CAGTCTCCTGTACACATAATACAAGCA
2565BG275007_4_B_64641SBEFORWARD392561.31444176.91T/C64CATATCAGTATAGCACAGCACCACA
2566BG275007_4_B_64642SBEREVERSE932759.9629.638298.21T/C64TCTTTAAAGGAAAATAAACTGACTGGA
2567BG275007_4_B_1331331SBEFORWARD1062755.5522.226385.39T/C133AATATTTGAACTTTATTAGTTGCTGAT
2568BG275007_4_B_3753751SBEFORWARD3482764.6240.744281.98T/C375GAAGATTTTGGTAAGGATGTTCCCTGT
2569BG275030_2_A_88881SBEFORWARD612761.1522.224390.34T/C88TCAGAAATGAAAAAAAAAACCATTGTA
2570BG275030_2_D_88881SBEREVERSE1172757.9622.225286.63A/T88ATTCAGTTACAGTGTTTTTTTTTTCAT
2571BG275030_2_D_1751751SBEREVERSE2022563.48443271.42T/C175GAGACTTCCTTTCAGGTGGATTTTG
2572BG275060_6_A_50501SBEFORWARD232764.3744.446385.63T/C50AGAGGCATACTTCTTTTCTGTCACTGC
2573BG275060_6_A_1641641SBEFORWARD1372750.5325.936268.67T/C164ATACTTCTTTCTTCTGTATACTTACTT
2574BG275060_6_A_1661661SBEFORWARD1392753.8229.636278.53A/T166ACTTCTTTCTTCTGTATACTTACTTCA
2575BG275060_6_A_3093091SBEREVERSE3382761.3929.634393.32T/C309CCCATGTTCAATGTGTAAGAAAATAAA
2576BG275086_7_A_27271SBEFORWARD12664.9938.465274.84T/C27TTCCTTGATGGCATGTTCACTTTCTA
2577BG275086_7_A_27272SBEREVERSE562760.4125.936397.53T/C27ATACGTTTAAAGTTGATTTTGTTGCAT
2578BG275102_4_A_6876871SBEREVERSE7162764.3140.744282.92G/T687GTAGGGTCATAAATGGATGGATCAAGA
2579BG275102_4_A_7757751SBEFORWARD748275929.634394.49G/T775GGGAGTATATTTTATGGATGAATTTGT
2580BG275102_4_A_7757752SBEREVERSE8052859.5328.574387.27G/T775CATTTACCGTTTTTTAATTGTACCTATG
2581BG275102_4_A_110311031SBEFORWARD10762759.1633.336396.22T/C1103TATAATACCCCGTAAATATTAGATCGC
2582BG275102_4_A_110311032SBEREVERSE11322762.0737.046392.54T/C1103GAGTGATGACTAAAATTCACACCATTG
2583BG275102_4_B_2492491SBEFORWARD2232663.3546.156178.7T/C249GTAGCCAGCTGCATTCCATATTACTC
2584BG275102_4_B_3293291SBEREVERSE3582758.9833.335395.05T/C329TCAATGTCTATTCTGTATAAATCTGGG
2585BG275102_4_B_9549541SBEFORWARD9282663.8938.467381.03A/T954TAGGATTTTTCCTCGAAAAGTGGAAG
2586BG275102_4_B_9549542SBEREVERSE9832764.440.746385.55A/T954TACACTTCGGGATACTGAAATTGTTCC
2587BG275102_4_B_116911691SBEFORWARD11432662.442.315384.27T/C1169CTCAAGGGCAATATAGTTTATCAGGC
2588BG275108_3_D_2442441SBEREVERSE2732763.8744.446285.47T/C244GACCCTCATATGCAATGTAGTCCTCTT
2589BG275108_3_D_2652651SBEFORWARD2382762.7637.044389.23T/C265GAAATTGGAAGAGGACTACATTGCATA
2590BG312827_6_A_3053051SBEFORWARD2792664.142.314276.86T/C305CTTTCAAGTCAGTCAACTTTCAGGGA
2591BG312827_6_A_6636631SBEREVERSE6922754.8325.935382.62T/C663GTAAGTAATTTGATTTAGACAAGCATA
2592BG312827_6_D_2252251SBEFORWARD1992662.4146.155384.22T/C225GTCATATCAGTCTTGTCAACTCCCTG
2593BG313179_2_A_1801801SBEFORWARD1542662.0146.158285.65T/C180ACACAAGTCATGTGACTAGGGAGTTC
2594BG313179_2_A_2482481SBEFORWARD2222664.4538.466277.06A/C248CATTAATATGGGAGAATGGATTTGGC
2595BG313179_2_A_2482482SBEREVERSE2772763.0737.048289.14A/C248TATCTCTTGTGCACTATGAAATGACCA
2596BG313179_2_B_1501501SBEREVERSE1782661.2138.468288.03G/T150ACCAGATCTGTAGCATTAATATGGGA
2597BG313179_2_B_2882881SBEREVERSE3172759.6833.334396.54T/C288AGCTCAAATCAGAAGAGAAAAACTAGA
2598BG313179_2_B_4934931SBEFORWARD4662763.9940.744385.52T/C493TTATGTACGCGCAAGCGATCTATACTA
2599BG313362_2_A_2582581SBEREVERSE2872756.4322.226286.37A/C258TTTTGATAAACTAATAAAACCATTCAC
2600BG313362_2_A_4334331SBEFORWARD4062764.7233.335383.98T/C433AACACAGAATCATGTCAAAACCATTCA
2601BG313362_2_A_4604601SBEREVERSE4892762.2337.044289.15T/C460AGGTTGGCTACTAAATTCTTGATTTCC
2602BG313362_2_D_4254251SBEFORWARD4002564.51405269.59T/C425GGCTGAACACAGAATCATGTCAAAA
2603BG313433_2_D_2402401SBEREVERSE2692759.3733.336396.86A/T240ACCTGTATTAATTCCATGTTAGCTTTC
2604BG313685_5_B_2762761SBEREVERSE3062859.835.716391.48T/C276GGCATGTGAATTCTACTATTACTGAAAC
2605BG313685_5_D_82821SBEREVERSE1102663.5638.466381.4T/C82CTTTGAGATGTAAAACTTGTGTGCCA
2606BG313707_5_D_1941941SBEFORWARD1682664.8646.154274.6G/T194GTGTTCTGTGCTATTCGTATGCTGCT
2607BG313707_5_D_2982981SBEFORWARD2732563.14406274.32G/C298CATGATTTAAACCGAACTGCAAGAG
2608BG313707_5_D_2982982SBEREVERSE3272761.0337.044292.74G/C298CACATTAAAGAATACTCCAGGCAACTA
2609BG313722_3_A_3103101SBEFORWARD2852563.4484170.64A/T310CTACAGTTGGTTAGGCAAAGAAGGG
2610BG313722_3_A_3103102SBEREVERSE3392764.2240.746284.43A/T310CTTTATCGATCTTTCAGGTCCAACAAC
2611BG313722_3_A_3573571SBEFORWARD3302760.8933.334293.16T/C357TCGATAAAGAAATAATGACTGTTCCAC
2612BG313722_3_D_2322321SBEREVERSE2612755.2133.337283.35T/C232ATGTACTGATAAATCACAGTAGACAAG
2613BG313722_3_D_3953951SBEFORWARD3702556.89368377.33T/C395AACAAGGTACCAGTGTTATGTGTTA
2614BG313722_3_D_3953952SBEREVERSE4242763.5637.044386.83T/C395AACATCCTTTATTTGCCTATCCAACTG
2615BG313738_2_B_91911SBEREVERSE1192663.7653.854379.55T/C91GTACTTCACCTGTGCTAGACGAGTCC
2616BG313738_2_B_1061061SBEFORWARD812564.33524371.19T/C106CTAATGGACATGGGACTCGTCTAGC
2617BG313738_2_B_1351351SBEREVERSE1622563.67406374.4T/C135AATGAAATGAATCTGCAGCGTACTG
2618BG313738_2_B_1381381SBEFORWARD1112764.6140.748386.17T/C138TGAAGTACCTTGGTTCTTTCACCATTC
2619BG313738_2_B_1591591SBEFORWARD1342562.87406275.15T/C159ATTCAGTACGCTGCAGATTCATTTC
2620BG313738_2_B_1721721SBEFORWARD1472562.2403275.26A/T172CAGATTCATTTCATTGCTGACTGAC
2621BG313738_2_B_1741741SBEFORWARD1482663.2634.623380.44A/C174AGATTCATTTCATTGCTGACTGACAA
2622BG313738_2_B_1761761SBEFORWARD1502664.5438.463274.93T/C176ATTCATTTCATTGCTGACTGACAACC
2623BG313767_1_A_52521SBEREVERSE812759.733.335193.91G/T52AAACTTGTACCATAACTTAAACCCTGA
2624BG313767_1_B_1051051SBEREVERSE1322559.98364279.65T/C105GAAGCACTTGAGAGAAAAAAACTTG
2625BG313767_1_B_1781781SBEREVERSE2052556.17325373.3T/C178CGTTTACTGTATTGCATAGAAAAGT
2626BG313767_1_D_1591591SBEFORWARD1322757.5229.634286.16T/C159TTGAGAGAAAAAACTTCTACCATAACT
2627BG313769_1_A_3163161SBEFORWARD2912563.71364271.37G/T316GCTGTAATTTGCTTTGCCTGATTTT
2628BG313769_1_A_3163162SBEREVERSE3452763.8137.044182.73G/T316ATATCCCAGCACAGAACAATACAATCA
2629BG313769_1_A_6956951SBEFORWARD6682758.0337.044188.27T/C695ATTAGTACCTTCCTCTCTTACATTTCC
2630BG313769_1_A_6956952SBEREVERSE7242761.6633.336292.1T/C695TTCCTCAAGGACCTAAATAAAACAAGA
2631BG313770_4_A_94941SBEREVERSE1232762.1233.334388.53T/C94CGAGGACATTTTTTTAAGGATGATATG
2632BG313770_4_A_1721721SBEREVERSE2012764.6140.745384.3T/C172GATGTCAAGTAGCGTGCAAGTTTCATA
2633BG313770_4_A_1751751SBEFORWARD1502562.85326376.86T/C175AATTGTGACATGAAAATTTGTGGCT
2634BG313770_4_A_6576571SBEREVERSE6862759.3733.336396.86T/C657ACCGAACTAGAAATATTATGGCTTATG
2635BG313770_7_D_1181181SBEREVERSE1472757.8929.634289.5T/C118TATTCTGGCTTATCCTATATCAAATGT
2636BG314157_1_A_1411411SBEFORWARD1162560.57328181.62T/C141TTTAGCTAAGCAAATAAGCAATGGA
2637BG314205_1_D_26261SBEREVERSE552762.9437.044388.69T/C26AGGTTGTGTAATTCCTTCACCATGATA
2638BG314205_1_D_1501501SBEREVERSE1772562.47364376.76T/C150GAAGCAGATTTCATTGTATTGCACA
2639BG314427_4_D_49491SBEFORWARD222755.6529.636284.04T/C49AATATTTTATCCTAACTGGACACTATG
2640BG314435_5_B_46461SBEFORWARD192758.6533.334190.12T/C46CTACTTCTGTTCTTTCATGTGCTTATT
2641BG314435_5_B_46462SBEREVERSE752758.1233.334188.52T/C46AAAAGGTAACTAATACAGCACCTAACA
2642BG314532_2_A_1271271SBEREVERSE1552664.8238.464274.7T/C127ATAAAACCTTCCCAAAAGGGCATCTA
2643BG314532_2_A_1861861SBEFORWARD1592761.5937.046292.31T/C186TGATTCTAGCTATATTTGTGCTCGTGT
2644BG314532_2_A_4464461SBEFORWARD4192762.7533.335387.65T/C446GTTGTTTGGTAAAAAATGAGGGAGTTT
2645BG314532_2_A_4464462SBEREVERSE4752762.3237.044288.87T/C446CAAAATGAGGGTAAGAAACTGCATAAC
2646BG314532_2_D_72721SBEFORWARD452761.0533.335394.99G/C72GCTTGTGTAAAGTTTTCTGTGGAAATA
2647BG314532_2_D_72722SBEREVERSE1022854.7228.576376.24G/C72CATCATTTCTATTATAAGCTAAGGTACT
2648BG314551_3_A_1621621SBEREVERSE1912761.5133.334291.32A/T162AGGTACTTCAGATTGCATTTACCATTT
2649BG314551_3_D_1411411SBEREVERSE1682564.72486371.26A/C141GAAGTCTAGCATCCACTATTGGGCA
2650BG314551_3_D_1621621SBEREVERSE1912759.637.045396.93G/C162AACAAGTTCTGACCTAATAACAGGAAG
2651BG314551_3_D_1791791SBEREVERSE2092857.7435.714384.05T/C179CCACATAGAGTAATGTCTAACAAGTTCT
2652BG604404_4_B_2352351SBEFORWARD2082764.5240.747385.81T/C235CACTGTAAGAGTGAACATGGGGATTTT
2653BG604493_4_B_2422421SBEFORWARD2162663.8946.154379.16T/C242CTGTCATTCCTGGTTGGGATATACTG
2654BG604493_4_B_2422422SBEREVERSE2712762.7940.743388.51T/C242TACACACACAAACAGAAGAATAGCCTG
2655BG604493_4_B_2762761SBEFORWARD2492758.2729.632187.72T/C276TATTCTTCTGTTTGTGTGTGTATTGTT
2656BG604493_4_B_3043041SBEREVERSE3332762.233.335391.51A/T304AAGCGCGATGTCCTACATAATAATAAA
2657BG604507_4_B_4284281SBEREVERSE4572761.2537.044393.74T/C428CATCGACAAACAAGAGGTTTACATATC
2658BG604507_4_D_1211211SBEFORWARD942758.1929.634290.4G/T121AGCTATACATTACAAGCAAAAACTGAT
2659BG604540_1_D_3033031SBEFORWARD2762753.0325.938277.43T/C303TAGAAGTGTATACATATTGGATTAAGA
2660BG604577_3_D_1601601SBEREVERSE1882654.0726.928375.53G/T160CATAATATTAAGCTGAAATACCTCTT
2661BG604577_3_D_2692691SBEFORWARD2422754.0225.935380.18A/T269CTTATTGACTTTGTAGATAATGAAACT
2662BG604641_7_A_1481481SBEFORWARD1212756.4629.636286.47G/T148GAGATTTGGAAGTCTTATAGCTTATTT
2663BG604641_7_A_2482481SBEFORWARD2212761.5937.047292.94T/C248GAGATTTCAAATGGACTACCACATACA
2664BG604641_7_B_2562561SBEFORWARD2292762.6640.744389.53A/T256GAGGGAGTAGCTTATTTTGACATTTCC
2665BG604641_7_B_4334331SBEFORWARD4062763.8440.745386.6A/C433AGGGACTTCTGAACTTTGATGGATATG
2666BG604678_4_A_2562561SBEFORWARD2292761.5237.046292.52T/C256ATTAATCTGGAGCTAAGTCAAAAGTGC
2667BG604678_4_A_2562562SBEREVERSE2842664.0438.463171.69T/C256AGATGAGGAAAAAAAACCTGAAGCAC
2668BG604678_4_A_2682681SBEREVERSE2972760.9129.635393.16G/T268ATAAATTAGCTCCAGATGAGGAAAAAA
2669BG604678_4_A_3233231SBEFORWARD2962763.5737.043182.84T/C323TTCATCTTAGGCTCTTGGTTGCTATTT
2670BG604678_4_B_4074071SBEFORWARD3802759.4933.334192.64T/C407TCTCAGGCTCTTAGTTGTTATTTTCTT
2671BG604817_5_D_62621SBEREVERSE912758.1329.637292.09T/C62AAAATAACACTCTTATGCTCTATCCAA
2672BG604817_5_D_1361361SBEREVERSE1632556.18286373.94T/C136AAAAACAGTTCCGTAGTTTTTCTAT
2673BG604857_7_B_2352351SBEREVERSE2642764.7633.335282.18T/C235TGTTGACAAATCAAAAGAACAGGCATA
2674BG604857_7_B_4824821SBEREVERSE5112757.725.935289.57T/C482AAGAAACAAATAAACTTTGATGAAGAC
2675BG604857_7_B_5085081SBEFORWARD4812760.329.635397.22G/C508CGAGTCTTCATCAAAGTTTATTTGTTT
2676BG604910_2_D_33331SBEFORWARD62762.9429.637288.88G/T33TTTTTGCAATATCTGAATTGGTTCCTA
2677BG604910_2_D_33332SBEREVERSE622762.8640.744183.36G/T33ACTATCGCCACCCTAGTACAAAAAATC
2678BG605258_2_B_42421SBEFORWARD152760.9540.747294.87T/C42AGAGAAGGTAACATACACTCCTCCAAT
2679BG605258_2_B_1861861SBEREVERSE2152764.0744.443181.34T/C186TGATTCTACCTCCCTTTCCTCTTCTCT
2680BG605258_2_B_1891891SBEREVERSE2182764.1744.444283.32G/T189ACATGATTCTACCTCCCTTTCCTCTTC
2681BG605258_2_B_2812811SBEFORWARD2562564.5446168.59T/C281AAATAGGTTGCCCAACTAATGGCTC
2682BG605258_2_B_3433431SBEFORWARD3162755.4525.935384.48G/T343ACTAATAATATAGGTTTCAAGCACAAT
2683BG605258_2_B_4144141SBEFORWARD3882659.7238.464288.31T/C414CCACTAGGTGATATTTATGTGGAGAA
2684BG605258_2_B_4144142SBEREVERSE4422656.4230.776381.35T/C414TAGCTAATGTAATTTGTTGTAGCTTG
2685BG605554_5_A_4634631SBEREVERSE4922763.0137.044388.47T/C463ACTAATATCCTTGGACCCGTAATTTCA
2686BG605554_5_A_4734731SBEREVERSE5022762.2840.744390.66T/C473CAACAAGACAACTAATATCCTTGGACC
2687BG605554_5_B_1511511SBEREVERSE1802762.4737.048392.58A/T151AGTATTCCTGATACAGGAGAAATGCAA
2688BG605554_5_B_1841841SBEREVERSE2132757.9225.933390.63A/T184AAATACCAAAAGGCTACACAAATAATA
2689BG605554_5_B_3003001SBEFORWARD2732763.9137.046285.34T/C300TTGAATTCTGTCATTGATACCACCACT
2690BG606097_1_B_4494491SBEFORWARD4222761.9637.042187.03T/C449TGAAGAAAGTGATGAAGAGGTATTGTG
2691BG606570_6_D_1381381SBEREVERSE1672759.9225.937396.9T/C138TTTTTTGGAATAATTTATCTATGTGCC
2692BG606586_1_B_1031031SBEREVERSE1322763.5737.044285.12G/T103TTCTTGTTTCCTTTATGCAGGCTTACT
2693BG606586_1_B_1321321SBEFORWARD1052763.5737.044183.45A/T132AGTAAGCCTGCATAAAGGAAACAAGAA
2694BG606586_1_B_1321322SBEREVERSE1592560.83327281.89A/T132TTTTCAAAACAGAAGTGCTTAATGG
2695BG606586_1_B_1341341SBEFORWARD1072762.4333.334288.53A/C134TAAGCCTGCATAAAGGAAACAAGAATA
2696BG606586_1_B_3243241SBEREVERSE3532761.4329.634391T/C324AACCAGTTTTTTGACCTTGTATTTGTT
2697BG606586_1_B_3273271SBEREVERSE3552660.0830.776389.54T/C327GAAACCAGTTTTTTGACCTTGTATTT
2698BG606586_1_B_3343341SBEFORWARD3072755.7425.937284.93T/C334TCTGTCAGATCAAGTAAATAACAAATA
2699BG606586_1_B_3343342SBEREVERSE3622663.1934.626278.53T/C334ATTTACCGAAACCAGTTTTTTGACCT
2700BG606586_1_B_3363361SBEFORWARD3092756.3825.934386.63A/C336TGTCAGATCAAGTAAATAACAAATACA
2701BG606586_1_B_3363362SBEREVERSE3652763.9337.046283.06A/C336GACATTTACCGAAACCAGTTTTTTGAC
2702BG606586_1_B_3513511SBEFORWARD3242759.9929.632292.34G/T351ATAACAAATACAAGGTCAAAAAACTGG
2703BG606586_1_D_3013011SBEFORWARD2742759.4825.933393.09G/C301TAAATAAACACAAGGTCAAAAAAGTGA
2704BG606625_2_A_6176171SBEFORWARD5902757.1625.934386.03T/C617TCCTTTTTTTTATGGTTTAGACTTTAG
2705BG606636_2_A_9289281SBEREVERSE9572764.5533.336382.13T/C928TTCAGCCTTGTAGCAACATTTTTTTTC
2706BG606636_2_B_2692691SBEFORWARD2422763.5437.046388.13G/C269AACCTTACATGTGCAGCATAGTTTTTG
2707BG606710_6_D_3583581SBEFORWARD3312762.0144.445392.1T/C358CCAGAGACCAAAGTTAGCTCATAGTTC
2708BG606710_6_D_3703701SBEFORWARD3432758.8837.045293.11A/C370GTTAGCTCATAGTTCACTGCTAAGAAA
2709BG606710_6_D_3723721SBEFORWARD3452758.8837.044394.15T/C372TAGCTCATAGTTCACTGCTAAGAAAAC
2710BG606710_6_D_3923921SBEREVERSE4212763.3640.745388.05A/C392TATTTTGTCTACTCGTGGCAGCTACAT
2711BG606710_6_D_4034031SBEREVERSE4332859.5532.144287.81T/C403CGTTGCTATTATTATTTTGTCTACTCGT
2712BG606710_6_D_4074071SBEREVERSE4372856.6528.574380.79T/C407TGTACGTTGCTATTATTATTTTGTCTAC
2713BG606710_6_D_4084081SBEREVERSE4372755.9125.934283.56T/C408TGTACGTTGCTATTATTATTTTGTCTA
2714BG606710_6_D_4144141SBEFORWARD3882664.94505274.99A/C414GTAGCAATGTAGCTGCCACGAGTAGA
2715BG606710_6_D_4144142SBEREVERSE4432755.0322.224280.94A/C414TATTGATGTACGTTGCTATTATTATTT
2716BG606710_6_D_4244241SBEFORWARD3972761.5437.044392.88T/C424TAGCTGCCACGAGTAGACAAAATAATA
2717BG606710_6_D_4244242SBEREVERSE4512561.68406278.7T/C424CTGCAGATTATTGATGTACGTTGCT
2718BG606780_5_A_1781781SBEFORWARD1512763.4637.044387.12T/C178ACATGCTTGATGTGAATGCTAAGAGTT
2719BG606780_5_A_1961961SBEFORWARD1692762.8644.446288.51A/T196CTAAGAGTTCCTTAGTAAATGCCCAGC
2720BG606780_5_A_3383381SBEREVERSE3652562.01362173.54T/C338CAAACAAATACAAGCAACAGCAAAC
2721BG606986_1_A_1581581SBEFORWARD1312761.7337.046291.88A/C158CAGTGAAATTAGTTTTGTTTCTCCCTC
2722BG606986_1_A_1581582SBEREVERSE1872759.9537.045397.99A/C158GGAGTAACAGTTCACGATTATATGGAT
2723BG606986_1_A_2682681SBEFORWARD2412758.2229.635392.79T/C268TAGTATCATATTCAGGCATGTTCATAA
2724BG606986_1_A_2682682SBEREVERSE2972763.3937.044285.66T/C268AAGTGTGATATGGACGAAAAGAAGGTT
2725BG606986_1_A_2812811SBEFORWARD2542763.2933.337389.49T/C281AGGCATGTTCATAATCAACCTTCTTTT
2726BG606986_1_A_2812812SBEREVERSE3082561.64364277.57T/C281CAAGCAAAAAGAAGTGTGATATGGA
2727BG606986_1_A_3883881SBEFORWARD3632561.74404277.29T/C388AGCTCTACAAAACAAGGGATGAGAA
2728BG606986_1_B_6516511SBEFORWARD6242754.6122.225280.29T/C651TGTCAAATATCATAAAGTAAGAAAATC
2729BG606986_1_B_6516512SBEREVERSE6792664.0242.314277.09T/C651CTTGCTATAACTGAAGCCGAAATCCT
2730BG606986_1_D_2972971SBEFORWARD2712653.2634.628373.11A/T297ACTCTTATATTAGTTTACAGAGGGAG
2731BG607036_1_B_1281281SBEFORWARD1012759.2125.934395.14T/C128TAATGAGATCAAAATAAAATCAAGCTG
2732BG607036_1_B_1491491SBEFORWARD1232664.3642.315378.38G/T149AGCTGGCATGAGACACATCAGTTAAT
2733BG607036_1_B_1491492SBEREVERSE1772664.946.156377.4G/T149GAGCTTTCCTGTACTGGCTAAATGGA
2734BG607088_2_A_2702701SBEFORWARD1792563.33444272.5T/C204CTATTGGGTACGTTGGTCTGAATGA
2735BG607141_3_A_1801801SBEFORWARD1532758.8129.636395.18T/C180TATTGGTTAAATTATCGATCTAGGGAT
2736BG607141_3_A_1801802SBEREVERSE2082661.0538.463183.72T/C180CTCTTTCCAGTTTGTAATGCCTATGT
2737BG607141_3_D_12121SBEREVERSE402662.9642.315382.58G/C12GACAGCAGACAATACCAGAAGTTCAA
2738BG607196_2_A_3553551SBEREVERSE3832660.5234.624389.27T/C355GCATGTATGTTGTTCATTTATCGACT
2739BG607196_2_D_1871871SBEFORWARD1612664.4434.625174.82T/C187CATTTTCAGAATAAATGCAATGTGGG
2740BG607203_2_A_3303301SBEREVERSE3582651.0426.925364.59T/C330GATAGCTTGTTTTACATAGTTAGTTA
2741BG607203_2_A_4754751SBEFORWARD4482759.5133.336397.27A/C475TATACCAATTACATGCTTGTGCTACTT
2742BG607230_1_D_21211SBEREVERSE502761.5137.045291.94T/C21CTGCACTATATTATTAGCCCTTTTTGG
2743BG607308_5_B_4494491SBEFORWARD4222764.8244.447283.25G/T449CAGGAACAGCTGCTATTTATCTGTGGT
2744BG607308_5_B_5755751SBEFORWARD5492660.7734.627390.39G/C575ATTCAGAGTTGGAAACTTGACTTTGT
2745BG607308_5_B_6436431SBEREVERSE6722762.9940.746389.78A/T643AAGCTGCAGAACTTATATGTGCCTATG
2746BG607308_5_D_3163161SBEREVERSE3452763.3733.334387.38T/C316AAGAAGAATCACTTTGGATTTCATGGT
2747BG607308_5_D_5055051SBEFORWARD4792658.930.777389.41A/C505ATTCAGAGTTGAAAACTTGACTTTGT
2748BG607308_5_D_5465461SBEFORWARD5192762.3840.744288.68T/C546AATATACTTCATACCCGTCATGTCCAC
2749BG607308_5_D_5465462SBEREVERSE5732563.27485273.33T/C546CCTATGTTCAACTGGTCAGCTATGC
2750BG607512_5_A_1461461SBEREVERSE1752764.4237.046385.48T/C146ATCATTCCAGAGTGAAAAGACAAAGGA
2751BG607512_5_A_2742741SBEFORWARD2472762.0440.745290.33A/T274CGAATATCAGTTATGCTGAGGGTACTT
2752BG607523_1_B_1691691SBEFORWARD1432658.1834.625385.99T/C169ATGTGTAACTGTCATCTTCTCATCAT
2753BG607523_1_B_1721721SBEFORWARD1452764.3744.443282.11T/C172GTGTAACTGTCATCTTCTCATCATCGC
2754BG607523_1_B_1751751SBEFORWARD1482762.0840.743288.96T/C175TAACTGTCATCTTCTCATCATCGCTAC
2755BG608151_3_D_67671SBEREVERSE942564.56523268.19T/C67TCCTACTGATACTGAGACGGGCACT
2756BG608151_3_D_70701SBEREVERSE972563.83564271.02G/C70CTCTCCTACTGATACTGAGACGGGC
2757BG608151_3_D_76761SBEREVERSE1052757.440.744389.71T/C76TGTGTATTCTCTCCTACTGATACTGAG
2758BG608151_3_D_1161161SBEREVERSE1442664.4942.313173.4T/C116GAATAAAAAGGTTGAGAGCAAGCAGG
2759BG608151_3_D_1261261SBEREVERSE1552756.6529.633183.49A/C126TACATAGACAAGAATAAAAAGGTTGAG
2760BG608151_3_D_1481481SBEFORWARD1222660.5234.623286.99A/C148CTTGCTCTCAACCTTTTTATTCTTGT
2761BG608232_2_A_6136131SBEFORWARD5862760.2737.044396.69T/C613AACTAGGCAACTAGCACAGAAAAACTA
2762BG608232_2_B_2612611SBEFORWARD2352664.9638.466377.22T/C261TTTTGCTATGATATCTGGTCGCTGAA
2763BG608232_2_B_3563561SBEFORWARD3312555.38286269.9T/C356TTTTAGATAAGATGTTGGCTATTTC
2764BG608232_2_B_3563562SBEREVERSE3852764.8248.154383.04T/C356AACAACCCCTATCAGCAGTATCTAGGC
2765BG608352_5_A_3223221SBEREVERSE3492564.84446269.22T/C322CACATCATCACAGGTGAAATCAAGG
2766BG608354_2_A_1001001SBEREVERSE1272564.36406372.33T/C100GATGCATTTCCGAGGCAATAGATTA
2767BG608354_2_B_15151SBEREVERSE442763.2437.044286.12T/C15GATTAACTCATCTTGTTTTGTTGCAGG
2768BG608354_2_D_23231SBEREVERSE522758.429.635291.66T/C23AGGTTAGAGAACTGCCATTTATATTTT
2769BG608354_2_D_93931SBEREVERSE1202564.04486373.29T/C93ACAGGAGTTTAAGTTCCGTGACTGC
2770BG608354_2_D_2732731SBEFORWARD2462760.2940.744396.63T/C273GTACATTAGATCCATACCTTGGTTACG
2771BI479207_5_A_2952951SBEREVERSE3232664.3938.465378.3T/C295AATCCAAGACAAGTAATTTGGAACGG
2772BI479207_5_A_3043041SBEREVERSE3332756.1429.636285.52T/C304TATCTAGACAAATCCAAGACAAGTAAT
2773BI479207_5_A_4074071SBEFORWARD3802762.4137.045390.9T/C407CAAATCTAAGACAAGTAATTCGGAACG
2774BI479207_5_A_5045041SBEFORWARD4772760.4625.934192.77G/C504ACCAATGCAAATATCTAAAGAACAAAA
2775BI479207_5_A_5045042SBEREVERSE5332756.9322.225287.26G/C504AATAATATGTTGATGTTGTTTGTTTTC
2776BJ224975_5_A_1231231SBEFORWARD982551.06208359.84T/C123AAATATAGCTTTGTTTAGTATTTTG
2777BJ224975_5_A_1361361SBEFORWARD1102660.6634.623388.21G/T136GTTTAGTATTTTGTTGTCTTGTGGCA
2778BJ224975_5_A_1361362SBEREVERSE1652763.4533.335286.1G/T136AGGAAAAATAAATGATGGTTTCAGGTG
2779BJ224975_5_A_1761761SBEFORWARD1492759.3529.634395.56T/C176ATCATTTATTTTTCCTGCTTATAGGTG
2780BJ224975_5_B_4804801SBEREVERSE5092764.9837.047384.42G/C480CTATCATTGTGCCAAAATCGCCTATAA
2781BJ224975_5_D_66661SBEFORWARD392756.7829.636287.43A/C66TATGCTAATGATAAATAGTGACCTGAT
2782BJ224975_5_D_66662SBEREVERSE952762.940.744388.8A/C66CTTAAAAGCCTACACGCTACACATCAT
2783BJ224975_5_D_80801SBEFORWARD532763.6544.445387.18T/C80ATAGTGACCTGATCCATGATGTGTAGC
2784BJ224975_5_D_80802SBEREVERSE1092752.4925.937275.19T/C80ACTAATAGTTAAAACTTAAAAGCCTAC
2785BJ224975_5_D_2892891SBEFORWARD2622755.6925.934282.9T/C289AAGTATAGCGTTGTTTAGTATTTTGTT
2786BJ248340_5_D_1301301SBEREVERSE1592762.2329.636290.39T/C130TTTAAATTTGGGAACTAAAAGGGACAT
2787BJ248340_5_D_4364361SBEREVERSE4652762.8733.333286.61T/C436GTCATTTTTGTTTTGCTTGGAGTCTTA
2788BJ277289_6_A_4954951SBEFORWARD4682761.3833.333291.06G/C495ATCTTTTGATGGAGAACTGTATGTTGA
2789BJ277289_6_A_5425421SBEREVERSE5702656.3726.928382.43T/C542TGTATACAGGAAACAAAGTTTAATCA
2790BJ291318_5_B_1201201SBEFORWARD932763.2833.334283.39T/C120AAAAAAAGTTCAGGGTACAAGTGGAAA
2791BJ291318_5_B_2422421SBEREVERSE2712761.2233.334393.84G/T242GCAACATAAATGGAAAGTATTTGAGTG
2792BJ309328_5_A_2152151SBEFORWARD1882759.0725.932190.14T/C215TTGGGCTATTTTCTATTTTCAGTTATT
2793BJ309328_5_D_2132131SBEFORWARD1862757.9437.044391.31T/C213GTGCTAATCTATCTAAAGTCGAAGGTA
2794BM134363_7_A_1971971SBEREVERSE2262764.9348.156383.97T/C197CTATTCGAGGATAGATGGGAGACACCT
2795BM134363_7_A_2282281SBEREVERSE2572764.7837.044281.5G/C228TCCTCATGGATCTCACAAAAGAAAAAG
2796BM134363_7_A_3033031SBEFORWARD2762764.0137.043384.84T/C303CATTTTTCCATTTGTCCTTTCTACGAC
2797BM134363_7_A_4094091SBEREVERSE4362564.74487371.82T/C409GTGGCTGCACAAATAGTGCTAAGGT
2798BM134363_7_A_5625621SBEREVERSE5912758.1633.332187.38T/C562TTTTTCTATCCTTCTGTGTCTATCTGT
2799BM134363_7_A_8948941SBEFORWARD8692561.72447279.22T/C894GGTAGGAAAAGCCTACCAGAAAAAC
2800BM134363_7_B_3073071SBEFORWARD2802764.5940.743281.44T/C307TTCCATTTGTCCTTTCTACGACTATGC
2801BM134363_7_B_5855851SBEFORWARD5582762.9244.442285.81T/C585AGAAACAGACAGAGACACAGGAGGATA
2802BM134363_7_B_5935931SBEFORWARD5662762.8140.742286.15T/C593ACAGAGACACAGGAGGATAAAAGGATT
2803BM134363_7_B_5935932SBEREVERSE6222761.4637.044393.12T/C593AATCTGGTCATACTGGTTTGGTAAGTT
2804BM134363_7_B_6656651SBEFORWARD6382756.3829.635387.25T/C665AGTAACTTCTTTTGAACAACTATCAGA
2805BM134512_6_A_3393391SBEREVERSE3662563.25443373.8T/C339CTTCTGGATACTTCTGCTGCTTGAA
2806BM134512_6_B_8178171SBEFORWARD7902755.4929.634282.32T/C817TGTATTGTCTTGTCTATCATTCTACAT
2807BM134512_6_D_2062061SBEFORWARD1792762.1640.743187.08T/C206GTCATCATTAGTCTTCCACACTCCTTT
2808BM134512_6_D_2062062SBEREVERSE2352759.3637.043191.64T/C206CAACAAACAGATACTACCAGAAGAAGA
2809BM134512_6_D_4904901SBEREVERSE5182662.0434.624283.05A/T490AACCACCAAGATTTTCTATCATCACA
2810BM134512_6_D_7607601SBEFORWARD7332764.4337.048285.03T/C760TTTGTTGACTGCAGTTCTGTTTTGTCT
2811BM134557_3_D_3323321SBEFORWARD3052762.3729.635391.01T/C332AATTTGATGATCTATTGGGTGAAAATG
2812BM135339_3_B_1041041SBEREVERSE1312563.6526171.3T/C104CCTGATCACTCCATAGACCTTCTCC
2813BM136727_6_B_2002001SBEFORWARD1732762.0533.336392.61T/C200TTGTTTAATGCATGGATATGGTAACAC
2814BM136727_6_B_5065061SBEREVERSE5332563.5445272.62G/C506GTCTAAGATTTGGGAGAAAACAGCG
2815BM136727_6_B_5705701SBEFORWARD5452563.65483270.94G/T570AGATGGGAGGAGATTAGACTGGGAT
2816BM136727_6_B_5705702SBEREVERSE5992762.944.444185.46G/T570GAGATCCTCTGTAGTTTTCCACTTTCC
2817BM136727_6_D_9369361SBEFORWARD9102655.6830.776379.13T/C936TAACAACTAGATTTTCGTCTGTGTAT
2818BM137730_4_D_34341SBEFORWARD72758.233.335392.72G/T34AACACTCATTTCTCTTTGAGGTTAGTA
2819BM137730_4_D_34342SBEREVERSE632760.837.046294.68G/T34CTGAGAACAAGATGTACAAACACGATA
2820BM137730_4_D_2982981SBEFORWARD2712763.7237.046387.58G/T298TTCTACAATTTTACTTGCCTCCCTTTG
2821BM137730_4_D_3453451SBEREVERSE3742761.3240.746293.11T/C345TCTGAATGTGTTAACTCTCAGTAAGGC
2822BM137835_6_A_1491491SBEFORWARD1222760.2229.635397.46T/C149AGAGAAAGTGCAGCTAATTTAACAAAA
2823BM137835_6_A_1491492SBEREVERSE1762561.51366380.88T/C149TGGTAAGAAAATTGTGCATAGCAAC
2824BM137835_6_D_66661SBEFORWARD392762.8640.748391.42T/C66ATATTTTTGCCTAGGTACAACGAGACC
2825BM137835_6_D_66662SBEREVERSE932564.73444268.32T/C66AGGCACCTTCAGCTTGCTAATTCTT
2826BM137835_6_D_1791791SBEREVERSE2082763.5533.336388.11T/C179GAAAATTGTGCATAGCAACTGTTTTGT
2827BM137879_1_A_5755751SBEREVERSE6042762.7840.744287.51T/C575TGTTTACTCTAACAAACGGTATCCTCG
2828BM137879_1_A_5945941SBEREVERSE6232761.540.743189.05A/T594GTTCCTCTGATTCTTCACCTGTTTACT
2829BM137879_1_B_5565561SBEREVERSE5852763.4637.044285.45T/C556AGGTTCCTTTGATTCTTCACCTGTTTA
2830BM137927_3_A_1571571SBEFORWARD1302761.637.047292.89A/C157ATTGATGTCATAATAGACAACGACCTG
2831BM137959_1_D_4444441SBEFORWARD4182663.5338.467280.46A/T444GTTTGCCAGTCTGGTGACATATTTTT
2832BM137959_1_D_4444442SBEREVERSE4732762.5433.337391.75A/T444GTAGTTGCCAAAGGCAAACAAATAATA
2833BM138178_4_A_1441441SBEREVERSE1712564.86483368.96T/C144AGAAAGAACTCGGCTCATAGGCTGT
2834BM138178_4_D_43431SBEFORWARD162761.6333.334290.93T/C43TTTTCCCTCTTTTAAGCCTGTATTGTA
2835BM138178_4_D_44441SBEFORWARD172761.3637.044291.74A/C44TTTCCCTCTTTTAAGCCTGTATTGTAG
2836BM138178_4_D_44442SBEREVERSE732759.6525.934396.44A/C44TGCAAATAGCCAAATACAATATAAATG
2837BM138210_3_D_47471SBEFORWARD202756.125.936183.73A/T47CTGTTGCAGTACTTCTTTATTTATTTT
2838BM138210_3_D_47472SBEREVERSE752660.0642.317290.87A/T47CTTACTCAGAGTCAAAAACAGTAGCG
2839BM138210_3_D_48481SBEFORWARD212756.4122.226184.65A/C48TGTTGCAGTACTTCTTTATTTATTTTT
2840BM138210_3_D_48482SBEREVERSE752555.99407272.35A/C48CTTACTCAGAGTCAAAAACAGTAGC
2841BM138650_7_D_2492491SBEREVERSE2782762.3829.636287.71G/T249CTTTGCTGCTAAATATTCAAAAAATGC
2842BM138650_7_D_2722721SBEREVERSE3012759.9833.334397.44T/C272TAAGTATCGAGAGATTGGTGTTTCTTT
2843BM140362_1_A_2052051SBEFORWARD1782759.1829.634191.71T/C205ATATAACTTTGCTATTTGGGTATTTGG
2844BM140362_1_A_2052052SBEREVERSE2342764.3748.154384.39T/C205AGAGGAAAGCGAGGAACATAGACCTAC
2845BM140362_1_B_46461SBEFORWARD192759.3533.336396.79A/C46GAACCATAGTTTCCAAAATAGTTCCTA
2846BM140362_1_B_1071071SBEREVERSE1362763.4740.744285.42A/C107CATAGACCTACAGCCAAATACCCAAAT
2847BM140362_1_B_1231231SBEFORWARD962761.533.336190.91T/C123ATATAACGTTGCTATTTGGGTATTTGG
2848BM140362_1_B_1231232SBEREVERSE1522763.4348.154387.21T/C123AGAGGAAAGGGAGGAACATAGACCTAC
2849BM140362_1_B_1301301SBEFORWARD1052564.25443269.11T/C130TGCTATTTGGGTATTTGGCTGTAGG
2850BM140362_1_B_1391391SBEFORWARD1122764.4144.444180.94T/C139TGGGTATTTGGCTGTAGGTCTATGTTC
2851BM140362_1_B_2092091SBEFORWARD1842564.36484371.1T/C209AGCTCAACATTCTCATCTGCCTAGC
2852BM140362_1_B_2202201SBEREVERSE2472564.03445372.71A/C220AGCATTACTGGCAGGTCCATATTGT
2853BM140362_1_B_3193191SBEREVERSE3472659.3330.778391.34T/C319CAATGTTTGTGCATACCTTGTTATTA
2854BM140362_1_B_3723721SBEFORWARD3462660.1546.155391T/C372GTAACAGTATTAGTGGACACCACGTC
2855BM140362_1_B_3923921SBEREVERSE4212758.9329.635293.25T/C392CAAAAGAATGGGTAATACTGATACAAA
2856BM140362_1_B_3933931SBEREVERSE4222760.6733.335396.13T/C393CCAAAAGAATGGGTAATACTGATACAA
2857BM140362_1_B_4114111SBEREVERSE4392660.7734.628187.69G/C411GGAATAGTACAAATCCACCAAAAGAA
2858BM140362_1_B_4314311SBEFORWARD4042763.6333.333284.31T/C431TATTACCCATTCTTTTGGTGGATTTGT
2859BM140362_1_B_4604601SBEREVERSE4892761.7640.746291.81G/T460GTCACTTTATAGGTGAAGCAGGAAAAC
2860BM140362_1_B_5305301SBEREVERSE5592758.7133.336394.87A/C530GAATCTAGAAAACTAAGATGACTGCAA
2861BM140362_1_B_5535531SBEFORWARD5262760.6837.044395.46A/T553CTGTCTTTGCAGTCATCTTAGTTTTCT
2862BM140362_1_D_40401SBEREVERSE692758.4333.336292.37G/T40ATATATTAAGCATCAATCTGCTGTAGG
2863BM140362_1_D_46461SBEFORWARD192759.3533.336396.79A/C46GAACCATAGTTTCCAAAATAGTTCCTA
2864BM140362_1_D_1071071SBEREVERSE1362763.4740.744285.42A/C107CATAGACCTACAGCCAAATACCCAAAT
2865BM140362_1_D_1231231SBEFORWARD962761.533.336190.91T/C123ATATAACGTTGCTATTTGGGTATTTGG
2866BM140362_1_D_1231232SBEREVERSE1522763.4348.154387.21T/C123AGAGGAAAGGGAGGAACATAGACCTAC
2867BM140362_1_D_1301301SBEFORWARD1052564.25443269.11T/C130TGCTATTTGGGTATTTGGCTGTAGG
2868BM140362_1_D_1391391SBEFORWARD1122764.4144.444180.94T/C139TGGGTATTTGGCTGTAGGTCTATGTTC
2869BM140362_1_D_2092091SBEFORWARD1842564.36484371.1T/C209AGCTCAACATTCTCATCTGCCTAGC
2870BM140362_1_D_2202201SBEREVERSE2472564.03445372.71A/C220AGCATTACTGGCAGGTCCATATTGT
2871BM140362_1_D_3193191SBEREVERSE3472659.3330.778391.34T/C319CAATGTTTGTGCATACCTTGTTATTA
2872BM140362_1_D_3723721SBEFORWARD3462660.1546.155391T/C372GTAACAGTATTAGTGGACACCACGTC
2873BM140362_1_D_3923921SBEREVERSE4212758.9329.635293.25T/C392CAAAAGAATGGGTAATACTGATACAAA
2874BM140362_1_D_3933931SBEREVERSE4222760.6733.335396.13T/C393CCAAAAGAATGGGTAATACTGATACAA
2875BM140362_1_D_4114111SBEREVERSE4392660.7734.628187.69G/C411GGAATAGTACAAATCCACCAAAAGAA
2876BM140362_1_D_4314311SBEFORWARD4042763.6333.333284.31T/C431TATTACCCATTCTTTTGGTGGATTTGT
2877BM140362_1_D_4604601SBEREVERSE4892761.7640.746291.81G/T460GTCACTTTATAGGTGAAGCAGGAAAAC
2878BM140362_1_D_5305301SBEREVERSE5592758.7133.336394.87A/C530GAATCTAGAAAACTAAGATGACTGCAA
2879BM140362_1_D_5535531SBEFORWARD5262760.6837.044395.46A/T553CTGTCTTTGCAGTCATCTTAGTTTTCT
2880BM140364_2_B_2962961SBEREVERSE3252761.740.745393.02T/C296AGGTACTCCCTCCGTTCCTAAATATAA
2881BM140364_2_B_5495491SBEFORWARD5222762.5837.045390.39T/C549AGCTAGGAAATCATTCAAGATACACGA
2882BM140477_3_D_1091091SBEREVERSE1372664.8842.315376.82T/C109GTTGGGTCATCTATTTTGAAACGGAG
2883BM140477_3_D_1181181SBEREVERSE1472757.8425.934391.02T/C118TTAATACAAAGTTGGGTCATCTATTTT
2884BM140477_3_D_1361361SBEFORWARD1112564.36405270.06A/C136CTCCGTTTCAAAATAGATGACCCAA
2885BM140477_3_D_1401401SBEFORWARD1142662.6534.625383.5T/C140CGTTTCAAAATAGATGACCCAACTTT
2886BM140477_3_D_1431431SBEFORWARD1182559.02324381.22T/C143TCAAAATAGATGACCCAACTTTGTA
2887BM140477_3_D_1631631SBEREVERSE1922759.2429.635395.85T/C163GTTTCAAAATAGATGACCCAACTTTAT
2888BM140477_3_D_1661661SBEREVERSE1932561.67365379.77T/C166CGTTTCAAAATAGATGACCCAACTT
2889BM140477_3_D_1801801SBEFORWARD1532754.7329.638282.53T/C180ACTAAAGTTAGTATAAAGTTGGGTCAT
2890BM140477_3_D_1881881SBEFORWARD1612756.4829.634285.26T/C188TAGTATAAAGTTGGGTCATCTATTTTG
2891BM140477_3_D_2022021SBEFORWARD1772564.07445270.91T/C202CATCTATTTTGAAACGGAGGGAGTG
2892BM140538_2_A_2192191SBEFORWARD1922758.2440.744392.23A/T219CTGTCTCTTTAGCTCCTAGTTCTAACA
2893BM140538_2_A_2192192SBEREVERSE2472661.9646.154283.28A/T219CACCTAGTAAGACGATAGATGGGGAT
2894BM140538_2_B_2322321SBEREVERSE2612762.7744.444389.18T/C232TAGGAGCTAAAGAGACAAGCAGTTGAG
2895BM140538_2_B_2392391SBEREVERSE2682762.0244.444391.44T/C239TCAGAACTAGGAGCTAAAGAGACAAGC
2896BM140538_2_B_2432431SBEREVERSE2722759.1740.744395.01T/C243AATGTCAGAACTAGGAGCTAAAGAGAC
2897BQ159467_3_A_1201201SBEREVERSE1492759.5237.048296.9T/C120CTACCGGTACTTGCATTATTTCTAACT
2898BQ159467_3_A_1791791SBEREVERSE2082763.6940.746286T/C179ATAATACCCTAAGCTTCCGTTGAATCC
2899BQ159467_3_A_2592591SBEFORWARD2342561.61366380.59A/T259GGCCATGTTATTTAGAACAAAGGAA
2900BQ159467_3_A_2722721SBEFORWARD2452756.3625.934386.57G/T272TTAGAACAAAGGAAATTATCAAGACTA
2901BQ159467_3_A_2722722SBEREVERSE3012761.0937.043393.6G/T272TCTTCTCTCACTTCCTTCAGTTACAAA
2902BQ159467_3_D_2062061SBEREVERSE2352760.0225.933396.81A/T206TTATTTCCCTTTTCTAATCACATTTTG
2903BQ159467_3_D_2212211SBEREVERSE2502758.1322.228292.72T/C221ATCTAATTTTGATCATTATTTCCCTTT
2904BQ159493_6_A_57571SBEFORWARD312664.81506377.66T/C57TCTCTAGACTGTGTGTTCACTGGCCT
2905BQ159493_6_A_84841SBEFORWARD592563.75446374.16T/C84CTTCATGATTGCAGGATGACCTAGA
2906BQ159493_6_A_2182181SBEFORWARD1932563.15367376.6T/C218CTTTGCACGAATTGAATTTTGACTC
2907BQ159493_6_A_3173171SBEREVERSE3462759.0537.044394.64T/C317AGACAATAACCACAAGCATCACTATAC
2908BQ159861_6_A_1001001SBEFORWARD732754.7925.934280.19T/C100TAACATAATAACATGACCAATAGAAGT
2909BQ160404_7_B_3133131SBEREVERSE3422764.4244.446283.83T/C313CTGCACCTGCTTAGGTGATTTCTTTAC
2910BQ160404_7_B_4634631SBEREVERSE4932861.1221.436182.52T/C463CTTGATCATTTTGATTTCAGTTTTTTTT
2911BQ160404_7_D_2592591SBEFORWARD2322756.6925.936388.82G/T259GATAAAAGATGGTCATTAATATTTCCT
2912BQ160404_7_D_2592592SBEREVERSE2872664.7142.314376.7G/T259TCTTATGGCAGCTCTTTCTTGTCAGA
2913BQ160404_7_D_4474471SBEREVERSE4742563.45443271.53T/C447CTGCTGTATGGGGTGTAAGTTGAAA
2914BQ160715_7_A_3043041SBEFORWARD278266334.624277.85T/C304ATAGATTTTGAGGATTTTTTCGAGGC
2915BQ160970_3_A_1161161SBEFORWARD892763.0837.044388.26T/C116TTAACCCCCTCATTTCCTCAAGTATAA
2916BQ160970_3_A_1161162SBEREVERSE1452763.8844.444284.18T/C116AATACTTCTAAGGGGTCGAATACCTGC
2917BQ160970_3_A_1651651SBEREVERSE1922563.89442066.25T/C165CAAAACAACCTCCAAAACTACACCC
2918BQ160970_3_A_2592591SBEFORWARD2342560.12326385.06T/C259ATTTGTGGGTTAGATACCCAATTTT
2919BQ160970_3_A_2592592SBEREVERSE2882764.1544.444283.39T/C259CTTTTAGTCTGCTTAACCCCCTCAAGT
2920BQ160970_3_A_4384381SBEREVERSE4652558.46328382.05A/T438GATGAACAAAATCTTTATTCTGCTG
2921BQ161196_2_D_3303301SBEFORWARD3032761.4240.743290.94T/C330CTCTGTAGTTGGAGAAGCAAGTGATAA
2922BQ161274_6_D_1311311SBEREVERSE1602756.3829.636387.88T/C131ACAGTAGACTTCTTAAAATCTCAAACA
2923BQ161465_2_B_2422421SBEFORWARD2152761.8137.046291.66A/T242TTGCTAGACATCTATGAAACACATTCC
2924BQ161544_6_B_1691691SBEFORWARD1422762.1844.443390.35T/C169CACCACATTAGTTACAGAACAGGTCAC
2925BQ161544_6_D_1041041SBEREVERSE1332757.229.634183.17G/T104TTAGTTCCTAGTCCTTTTTTTAATCTG
2926BQ161574_5_A_3073071SBEREVERSE3362759.5729.634294.53G/T307ATAATGCTGAAAGTGATGTGTTTCTAA
2927BQ161574_5_A_3203201SBEFORWARD2932758.3725.936393.87T/C320TTTTCTTCACACAATATTAGAAACACA
2928BQ161574_5_A_3203202SBEREVERSE3492761.9540.746291.23T/C320TAGCTAGGAGACCATAATGCTGAAAGT
2929BQ161619_7_B_1071071SBEFORWARD802759.5933.336295.84T/C107AGTTTTTGAGCTGTATCTCATTTTACC
2930BQ161619_7_B_1071072SBEREVERSE1362754.2929.634380.36T/C107TGATTTTAAGGTATAAGTACACAGACT
2931BQ161619_7_B_6666661SBEFORWARD6412556.77365375.09T/C666TGCTATATTCCACTTGAACTTACAC
2932BQ161619_7_B_6666662SBEREVERSE6952761.5133.334291.32T/C666ACTCATGTGGCCTTTTATGAATACTTT
2933BQ161779_6_A_2682681SBEFORWARD2432560.84404279.97T/C268GTCCATATTACTTGTCGCTGCTTTA
2934BQ161779_6_B_5335331SBEREVERSE5602562.57404173.12T/C533CGATCCATATTACTTGTCGTTGCTT
2935BQ161779_6_B_5855851SBEFORWARD5602563.1484273.2T/C585GAGGGAGTACATTGGAAAGAGGCTA
2936BQ161779_6_D_2662661SBEFORWARD2412562.33484275.51T/C266CTAGCCTCTTTCCAATGTACTCCCT
2937BQ161779_6_D_6196191SBEFORWARD5942564.92406268.99G/T619ATGCATGTTATTGATTGTTCCCCAC
2938BQ162119_5_A_3053051SBEFORWARD2782764.5340.744282.24T/C305TGGATCTCAGGTAATTCTTCTGCACTT
2939BQ162119_5_A_3213211SBEFORWARD2942756.6729.634387.51T/C321CTTCTGCACTTGTGATTTTATTAGTAT
2940BQ162119_5_B_35351SBEREVERSE622562.45484275.14T/C35GCATATAACTCTGACAACCCTGCTC
2941BQ162119_5_B_1401401SBEFORWARD1152557.38327276.52T/C140AATGACATTTAGCTCTTTCTTCAAC
2942BQ162119_5_B_1701701SBEFORWARD1432764.0833.336183.18G/T170TAATTATAACAAAGCCAATGCCGAAAC
2943BQ162119_5_B_1701702SBEREVERSE1992758.7929.636395.11G/T170GTGATTTGTTGATGAAAATATGGTACT
2944BQ162650_3_B_1231231SBEFORWARD962762.4829.638290.89T/C123CATGGAATTCCCGAATTAAATAAAGAT
2945BQ162650_3_B_2452451SBEFORWARD2192663.8634.626278.82T/C245CATTTGAATGTTTTCGCTTATTCCTG
2946BQ162650_3_B_2612611SBEFORWARD234276133.335293.46T/C261GCTTATTCCTGAAAGAACATATTGTGA
2947BQ162650_3_B_2722721SBEREVERSE3002663.3146.154279.24A/T272TCTCTCCTGATTACGTTTCTCCTGTC
2948BQ162835_4_A_1111111SBEFORWARD862564.81444369.73T/C111ACAAGTGCAAAGAATTAGTCGGCTG
2949BQ166400_6_B_6786781SBEFORWARD6532563.03406376.33T/C678CAGCAGGGACATTGATCATAAAAAG
2950BQ166400_6_B_105610561SBEFORWARD10292759.4140.746295.3G/T1056GATTGGTATAGCGTATAGTTACCTCGT
2951BQ166400_6_B_105610562SBEREVERSE10852762.8237.045288.01G/T1056TTTCTTTGTCTGGGGATTAAATAGGTC
2952BQ166400_6_B_127612761SBEREVERSE13052762.2333.334289.13T/C1276AGTTTTGCAGTCAATTCTCTATTTTCG
2953BQ166579_6_B_2112111SBEFORWARD1842760.9733.336294.17A/C211AAGTTCAATTATAAACAAGGAACACCC
2954BQ166999_5_B_1101101SBEREVERSE1372561.98442173.65T/C110GCAAGTAAAGAGCAAGGTCAAGAAG
2955BQ166999_5_B_3813811SBEFORWARD3542759.1325.934293.22G/T381AACTGGCACTAGCATTTTTATTTTTAT
2956BQ167013_6_A_1771771SBEFORWARD1502764.540.747182.55G/C177TGCAAGGACCTTATATTTCTGACCAAC
2957BQ167501_5_A_6086081SBEFORWARD5812760.3729.637296.58T/C608TTATTTGTCAATAAGTAGGCACCATTT
2958BQ167501_5_A_6086082SBEREVERSE6372759.525.938398.5T/C608AACAACAAAAGTATACTCAAAATGCAA
2959BQ167501_5_D_2432431SBEFORWARD2162757.2425.934287.56A/T243TGGGTTCTATTCTTCATTTTTATAGTT
2960BQ167580_3_A_3423421SBEFORWARD3152755.5325.936283.67T/C342TGTATCCTTCTTTTATTAATCTGAACT
2961BQ167580_3_A_4204201SBEFORWARD3932757.2425.937391.09A/C420GTTCATATTTGTGATTATCATGTTTTC
2962BQ167580_3_A_4204202SBEREVERSE4492761.7237.044290.67A/C420TTTGAGGTTTATACAGCAGAGAGAACA
2963BQ167580_3_A_4214211SBEREVERSE4502760.5337.044395.91A/T421TTTTGAGGTTTATACAGCAGAGAGAAC
2964BQ167580_3_D_1501501SBEREVERSE1792762.6937.046289.03G/T150AACGGAGGGAATATTATACAAAACAGC
2965BQ167580_3_D_1621621SBEFORWARD1352763.6540.748287.38T/C162GTATGCATATCTGGAGTGCTGTTTTGT
2966BQ167580_3_D_4724721SBEFORWARD4452752.7125.936376.89G/C472ATTAATCTGAAATATATACCCTGTACT
2967BQ167791_7_A_77771SBEREVERSE1062762.6540.744389.55T/C77CGATAACCTATTGTATCCCCTTCCTTA
2968BQ167791_7_B_63631SBEREVERSE922762.6540.744389.55T/C63CGATAACCTATTGTATCCCCTTCCTTA
2969BQ167890_6_A_3603601SBEREVERSE3892758.9425.935293.26T/C360AAACATAAATAAACACATTGATCTTGC
2970BQ167890_6_D_1001001SBEFORWARD732764.7140.747283.59A/C100CTGTTTGTTGGTAAGAAACCTTGTGCT
2971BQ167890_6_D_1001002SBEREVERSE1272562.22444174.19A/C100CTACATTTCTTCCACAGAACAACCC
2972BQ167890_6_D_3253251SBEFORWARD2992663.1842.316382.55A/T325ATCTGACAGTGCTGTTTACCGTGATA
2973BQ167890_6_D_4694691SBEFORWARD4422759.0337.044394.59G/T469TTAGCTGTTTGCTCTAGTTCTGTTTAG
2974BQ167890_6_D_4694692SBEREVERSE4982762.433.335289.27G/T469AATTCAATACTCAAAGAGCCACAACAT
2975BQ168165_5_D_1231231SBEREVERSE1522757.9822.228393.93T/C123AAGTCAATAAACCTTTTGTGAATTAAA
2976BQ168298_7_B_1291291SBEFORWARD1022761.7133.334290.69A/C129TAGGGTCTATAAAATGCAAAACAATCC
2977BQ168298_7_B_1291292SBEREVERSE1582763.8340.744182.69A/C129GAATTTAGCACACAGGCAATCTAGTCA
2978BQ168298_7_B_2242241SBEFORWARD1982663.7938.464377.14T/C224CATGGCTGGTAGCATAATTTTTTGAC
2979BQ168298_7_B_2242242SBEREVERSE2522663.8338.464277.69T/C224AGAACCCAATTTAGCAACAAAGAAGG
2980BQ168298_7_B_2872871SBEFORWARD2622560.14366385.01T/C287ATTAACCCCTGAAAAGCATTTACTC
2981BQ168298_7_B_2872872SBEREVERSE3162760.4629.636295.7T/C287TAATGCAATAAAATCTAGCAGAAAAGC
2982BQ168298_7_D_1121121SBEREVERSE1412763.2833.334387.65A/T112CAACAAAATTAGCACACATGCAATCTA
2983BQ168298_7_D_1501501SBEFORWARD1242662.5838.464179.77T/C150GTGTGCTAATTTTGTTGGATCTGTGT
2984BQ168298_7_D_3643641SBEREVERSE3932754.5522.226280.75T/C364GTATATAATGCAAACATAAATCAAAGT
2985BQ168298_7_D_4854851SBEFORWARD4602564.82527371.59A/C485GATCAGGTTTGAGAGCCTGACTGAC
2986BQ168706_3_B_120912091SBEREVERSE12382761.2237.046293.42T/C1209CCTACAAATATGATCAGAACAATCCAG
2987BQ168780_5_B_5175171SBEREVERSE5442564.52404370.6G/C517GACTTCTGTTTTTCCATGTGCCATT
2988BQ169383_2_D_2402401SBEREVERSE269276137.047396.38A/C240GTCCACATTATGTCAAAGAACTCACTT
2989BQ169448_6_A_2002001SBEFORWARD1752564.77364367.44A/T200GTGAACAAGGAAATGCAAAAAATGC
2990BQ169448_6_A_2002002SBEREVERSE2302850.5621.436363.76A/T200GTATATTAAGACTTTACTTAAAAACACT
2991BQ169448_6_A_2742741SBEFORWARD2472762.6233.335288.59T/C274ACAAAAATGTTGCTAACCAGATAATGC
2992BQ169448_6_A_2742742SBEREVERSE3032759.2633.336396.52T/C274AGCAGAATGGTCTGTTTAAATATCTCT
2993BQ169448_6_A_2762761SBEFORWARD2492762.7133.334389.38A/T276AAAAATGTTGCTAACCAGATAATGCAG
2994BQ169448_6_A_3253251SBEREVERSE3542760.0937.044193.9T/C325CTGTATGTTGTTAGCTGTTTGTTGAGT
2995BQ169448_6_A_3533531SBEFORWARD3262760.433.334192.97G/C353AACTCAACAAACAGCTAACAACATACA
2996BQ169448_6_A_3863861SBEFORWARD3612564.97447269.45T/C386ACTATTCAGGCCCTCGAAACCATAA
2997BQ169448_6_A_4144141SBEFORWARD3872754.4225.936382.01T/C414TAAAACTAATCTGGTGTTAGGTTAATA
2998BQ169448_6_A_4424421SBEFORWARD4152760.7844.444293.49A/C442GTGCAGAGCTACATAGAAGAACTAGGA
2999BQ169448_6_A_4824821SBEREVERSE5112764.4448.154384.17T/C482CATGTTATAGTCTCCTCCTGCTGATCC
3000BQ169448_6_A_5085081SBEFORWARD4812763.244.444286.24T/C508AATGGATCAGCAGGAGGAGACTATAAC
3001BQ169448_6_A_5125121SBEFORWARD4852763.1344.444388.12G/C512GATCAGCAGGAGGAGACTATAACATGA
3002BQ169448_6_A_5295291SBEFORWARD5042564.3408373.76T/C529TAACATGAGCATGCTTCTCAGCAAT
3003BQ169448_6_A_5655651SBEFORWARD5402564.72326368.85G/C565TGCATGGTGCAATATTCATTTTTTG
3004BQ169448_6_B_4084081SBEREVERSE4372764.4737.045283.06T/C408TTTTCTCAATTTGGGTCCTGTTTAGTG
3005BQ169448_6_D_4704701SBEFORWARD4442660.2930.774288.29T/C470CAAAATTGAGAAAACTGAAACATGAC
3006BQ169501_7_A_2962961SBEFORWARD2692758.5233.338293.89T/C296AATGATCATAACAGATAAGAACTAGCG
3007BQ169669_7_B_3793791SBEREVERSE4082764.9440.748181.85T/C379GGCATTAATAGCCAAAAACTCACCTTC
3008BQ169707_2_D_1821821SBEFORWARD1562661.1230.772180.21T/C182GTGAACTGATGAAGAAAGGAAAAAAA
3009BQ169999_5_A_93931SBEFORWARD662760.6337.046295.2T/C93GTTGCAAACTAAGAAGAACCATCATAC
3010BQ169999_5_A_2552551SBEFORWARD2282760.2533.336397.99T/C255CACATGTTCATTGAGGTATATATTGGA
3011BQ169999_5_A_2872871SBEREVERSE3162755.0429.634382.61T/C287TCACCTCATATTTATCTTCATATACAC
3012BQ169999_5_B_3013011SBEFORWARD2742754.1425.936279.52T/C301AGAAATGTAAATATTACTAAGCAGATG
3013BQ169999_5_D_3743741SBEFORWARD3472761.7333.336190.24A/T374GATAAATATGAGGTGAAATTTGGGAGA
3014BQ170025_5_B_4124121SBEREVERSE4412755.3725.938386.12T/C412AAGGTTATCCTTTAGTTGATATAATGA
3015BQ170165_7_A_1051051SBEFORWARD792662.2534.628284.92T/C105GCATTTAAATTGTTTTAGAAGTGGGC
3016BQ170165_7_A_1051052SBEREVERSE1342754.7225.934381.67T/C105TAAAGTAGACAATGACAAGAAATTAAC
3017BQ170165_7_A_2232231SBEREVERSE2502562.71446377.28A/T223GGTACCAATGTTGTCCAGAGAAGAA
3018BQ170165_7_B_97971SBEREVERSE1262764.1137.044181.82T/C97ATAAGGTCCGAATAAGTTTCCTTTCCA
3019BQ170165_7_B_99991SBEREVERSE1282762.4837.044390.06T/C99CAATAAGGTCCGAATAAGTTTCCTTTC
3020BQ170165_7_B_1181181SBEFORWARD912758.9329.634292.64T/C118GATATAAATGGAAAGGAAACTTATTCG
3021BQ170165_7_B_1181182SBEREVERSE1452559.7288284.11T/C118TAAAACGATTTAAATGCCAATAAGG
3022BQ170165_7_B_2822821SBEREVERSE3092562.43404275.22T/C282AGTGTTGTGGATGAACGTCTTCTTT
3023BQ170165_7_B_3013011SBEFORWARD2752664.3242.317379.75T/C301CTGTTTGTCAAAGAAGACGTTCATCC
3024BQ171182_6_A_19191SBEREVERSE482764.0137.047387.33G/T19TACCATCATGTGAGCATGAAAGCTAAT
3025BQ171182_6_A_1201201SBEFORWARD952564.83404369.68T/C120ATGTGGCATTTAACAATCTGGCTGT
3026BQ171182_6_A_1201202SBEREVERSE1472559.92323179.96T/C120ATCAAGAGCATCATCACAAATAACA
3027BQ171182_6_A_3083081SBEFORWARD2812757.8633.336392.34G/T308TACAGCTTATGCTAGTTTTATGTACCA
3028BQ171182_6_A_3083082SBEREVERSE3372757.422.223389.08G/T308ACAAGAAAACAATAGCAAAAGAATAAT
3029BQ171182_6_A_3093091SBEREVERSE3382758.222.222187.51A/T309AACAAGAAAACAATAGCAAAAGAATAA
3030BQ171182_6_A_3643641SBEFORWARD3372756.2425.936285.81T/C364TCTAACTTGATCTAATTCATTTGTCTT
3031BQ171182_6_A_5035031SBEREVERSE5302560.09484383.9T/C503GTCCTAGCATAGTCAAGGGAGTACA
3032BQ171182_6_A_6356351SBEFORWARD6092664.0446.154277.06T/C635ACTCTCAAGTCAGATGGTATTGCTGG
3033BQ171523_6_B_3973971SBEFORWARD3722564.24443269.15T/C397ATCTGTTCTTTTCTTGCTGCCTCAC
3034BQ171523_6_B_3973972SBEREVERSE4252663.2234.624279.49T/C397AGCCTTAATGTTGGTTGAAGTGAAAA
3035BQ171683_7_A_1891891SBEFORWARD1622754.3522.226280.14A/T189ATTAATAGAAAAACAAAGATGACTACA
3036BQ171683_7_A_4844841SBEFORWARD4572757.3122.224183.12T/C484CAAGTACGAAAAAAAACAAATATACAA
3037BQ171683_7_B_92921SBEFORWARD652759.5133.337397.91A/C92AGAGCATCAGTTGTTCTCTAAAAAGTT
3038BQ171683_7_B_2942941SBEFORWARD2672762.7637.043388.6G/T294TAATGGTATTGACTTGGTATCGTGGAT
3039BQ171683_7_B_2942942SBEREVERSE3232760.0825.934395.03G/T294TGACCAAGTTCATACAAAAAACAATTA
3040BQ171683_7_B_6106101SBEREVERSE6392762.1929.638291.76T/C610TAGATTAATGCGCATATTTGGTTTCTT
3041BQ171931_3_A_76761SBEFORWARD512556.72368376.83T/C76GAGGTTAATTAAAGGTAAGCTCAGA
3042BQ171931_3_A_76762SBEREVERSE1042663.2242.317281.4T/C76GTTCTCCAGAAGAAGCTCAATGGTAA
3043BQ171931_3_A_2212211SBEFORWARD1942764.2440.744283.13T/C221GATCTTTGATTGTGTGAACTTTAGCCC
3044BQ172173_2_B_1571571SBEFORWARD1322561.65363276.91T/C157ATC